Busch Lab

ZMP

ing5a

Ensembl ID:
ENSDARG00000022413
ZFIN ID:
ZDB-GENE-031016-1
Description:
inhibitor of growth protein 5 [Source:RefSeq peptide;Acc:NP_001093519]
Human Orthologue:
ING5
Human Description:
inhibitor of growth family, member 5 [Source:HGNC Symbol;Acc:19421]
Mouse Orthologue:
Ing5
Mouse Description:
inhibitor of growth family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1922816]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1695 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29697
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040701 Nonsense 110 242 4 8
Genomic Location (Zv9):
Chromosome 22 (position 2195779)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2936869
GRCz11 22 2953135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACAAGCACATCAGAAGACTGGACGCTGATCTGGCTCGCTTTGAGAAC[G/T]AGCTGAAGGAGAAGCTGGACGTTAGCGGCTATGAGAGTCCAGATAACAGA
Long Flanking Sequence:
ATAACACAATGCAAACAAATATTTATATTAATGTCACATAATTAAATTAATTAAAAAAATCCATATTTAATCAATAATGATATAGATTTATGGAATTTTTTTGTCTTTCTTTTGTCTCTTCTTTTTTTCAGAGAAGAAATGTGAAATCGATAAACTGGCGGAGGAATACATCGCTAATGTGCGCAACCTGGCCCCAGATCAGAGAGTGGAGCATCTGCAGAAGATCCAGAACGGCTTCAGCAAATGCAAAGAGTACAGCGACGATAAAGTGCAGCTCGCCATGCAGACCTACGAGATGGTCAGTGCTGGATCTCATTCATTTATAAATAAAAGGTTTTGCAAAATGCTGGAGCAGAAGTGATAAGTTTTTCTTTTTGTGTTCATTACAATATCTGCATTTCTACAGAGTTTATTATAGATCCGATTATATTTTTGTTTAAAACAACCAGGTGGACAAGCACATCAGAAGACTGGACGCTGATCTGGCTCGCTTTGAGAAC[G/T]AGCTGAAGGAGAAGCTGGACGTTAGCGGCTATGAGAGTCCAGATAACAGAACGCACAAGAGTAAGACATTAAACTCTAAATTATAAATTACTCGATACATAACATAAATATATACGGCTGTCTGGAATACTCGCGTCTGATTGGTTAGTTGTGGCTTCCCAAGGTATTTTATTCCCAGATAACAACTTCTAAATAACACAGACTCATCTGGGAACTTCCACTCATCTTGATCTTCAGAAAATACCTTCATATTTATATACTTTCACATTTATGTTTTTAAGCGCCGTCTAGTAAATGAATAAAACATAAGTTAGTGTATACTCCATCAGCTGTTTTCGTTTTTGTCAGCTTTGTTTCTGACAGTTTGGCGCCATCTTGTGTCTGAATAATGTGCAGGTTAGTGTATACTCCATCAGCTGTTTTCGTTTTTGTCAGCTTTGTTTCTGACAGTTTGGCGCCATCTTGTGTCTGAATAATGTGCAGGTTAGTGTATACTCCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29696
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040701 Nonsense 135 242 5 8
Genomic Location (Zv9):
Chromosome 22 (position 2194258)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2935348
GRCz11 22 2951614
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTAAGAAAATAAACCCAAACACTGTTCTTCACAGAGGTCACTGGCAGA[G/T]GAAACCTGAAGGAGAAACGGCGCCCCAAAGGAAGAGGACGGAAATCTTCA
Long Flanking Sequence:
TAGTGTATACTCCATCAGCTGTTTTCGTTTCTGTCAGCTTTACGTTTCTGACTGTTTGGCGCCATCTTGTGTCTGAATAATTTGCAGGTTAGTGTATACTCCATCAGCTGTTTTCGTTCCTGTCAGCTTTACGTTTCTGACTGTTTGGCGCCATCTTGTGTCTGAATAATGTCCAGGTTAGTGTATACTCCATCAGCTGTTTTCGTTTCTGTCAGCTTTACGTTTCTGACAGTTTGGCGCCATCTTGTGTCTAAATAATGTGCAGGTTAGTGTATACTCCATCAGCTGTTTTAGTTTCTGTCAGCTTTGCATTTTTATCAGTTTGGCGCCATCTTGTGTCTGAATAATCCACAGGTTAGTGTGGTTAGCCATCCCTGTTTGGCACCATCCTAATATTGATTATGATTTTTTTCCCATATTTGAGCAGCTGTAAATTATACTTTAATGATGCATTAAGAAAATAAACCCAAACACTGTTCTTCACAGAGGTCACTGGCAGA[G/T]GAAACCTGAAGGAGAAACGGCGCCCCAAAGGAAGAGGACGGAAATCTTCAGACGACGAATCGCCGCGGAAAAAGAAAATGAAGAACAGGTTGGTGTCAAAAAGCACATAGAAAACGATGACAACAAATATTTTGAAGTGAAATTTACTCTGTTTTCTTTGGATTGCATAGTCCTGAGTTCCCAGAATCCATCTTACCGGTTCATCCGTCAGACGTTTTAGACATGCCCGTCGATCCCAACGAACCTACCTACTGCCTGTGTCACCAAGTGTCATACGGAGAAATGATCGGATGTGACAACCCAGATGTAAGAGCACAATCAAATTTTTTCAGAGAGATAGTTCACCCAAAACTGAACATTTATTTACCCTAAAGTACCTTAAAATCGTTTCTTTTTTCTGTAGAACACAAAATATATTCTGAATAGGAGTGACGATGACTATGATTACTGCACTTCCTTTACCATAAACCAAAATACATGGCCGCTGTTTTAAACTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1695
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040701 Nonsense 204 242 6 8
Genomic Location (Zv9):
Chromosome 22 (position 2193969)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2935059
GRCz11 22 2951325
KASP Assay ID:
554-1641.1 (used for ordering genotyping assays)
KASP Sequence:
ACGAACCTACCTACTGCCTGTGTCACCAAGTGTCATACGGAGAAATGATC[G/T]GATGTGACAACCCAGATGTAAGAGCRCAATCAAATTTTTTCAGAGAGATA
Long Flanking Sequence:
TTTAGTTTCTGTCAGCTTTGCATTTTTATCAGTTTGGCGCCATCTTGTGTCTGAATAATCCACAGGTTAGTGTGGTTAGCCATCCCTGTTTGGCACCATCCTAATATTGATTATGATTTTTTTCCCATATTTGAGCAGCTGTAAATTATACTTTAATGATGCATTAAGAAAATAAACCCAAACACTGTTCTTCACAGAGGTCACTGGCAGAGGAAACCTGAAGGAGAAACGGCGCCCCAAAGGAAGAGGACGGAAATCTTCAGACGACGAATCGCCGCGGAAAAAGAAAATGAAGAACAGGTTGGTGTCAAAAAGCACATAGAAAACGATGACAACAAATATTTTGAAGTGAAATTTACTCTGTTTTCTTTGGATTGCATAGTCCTGAGTTCCCAGAATCCATCTTACCGGTTCATCCGTCAGACGTTTTAGACATGCCCGTCGATCCCAACGAACCTACCTACTGCCTGTGTCACCAAGTGTCATACGGAGAAATGATC[G/T]GATGTGACAACCCAGATGTAAGAGCACAATCAAATTTTTTCAGAGAGATAGTTCACCCAAAACTGAACATTTATTTACCCTAAAGTACCTTAAAATCGTTTCTTTTTTCTGTAGAACACAAAATATATTCTGAATAGGAGTGACGATGACTATGATTACTGCACTTCCTTTACCATAAACCAAAATACATGGCCGCTGTTTTAAACTCAAGTACTTTCACTTTCACTTTCAAATTTACTTTCACTTTCACATTTGCGATGGCTTTCCAGGGAGTTATATTAAACGTATTTAAATATGTGTAATATGTCTACAAATATTAAACATTTATTTCAATATGTTTGTATTTATTCCAGAATTCTAACCATTAGAATAGCCGTCACATACATGGTAAAATATATAAACTGTACTTTTATATACAGTAAATGTTCAAGTCAATCACAGTTATTTATTAGGTAATTAACCATCTACATATAAGAGACAAATTCCTTGAAATATGCTAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461