Busch Lab

ZMP

dspa

Ensembl ID:
ENSDARG00000022309
ZFIN ID:
ZDB-GENE-030131-2743
Description:
Novel protein similar to vertebrate desmoplakin (DSP) [Source:UniProtKB/TrEMBL;Acc:A2AVI3]
Human Orthologue:
DSP
Human Description:
desmoplakin [Source:HGNC Symbol;Acc:3052]
Mouse Orthologue:
Dsp
Mouse Description:
desmoplakin Gene [Source:MGI Symbol;Acc:MGI:109611]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa19650 Nonsense Available for shipment Available now
sa30809 Nonsense Mutation detected in F1 DNA Not yet available
sa13356 Nonsense Available for shipment Available now
sa302 Nonsense F2 line generated Not yet available
sa38306 Nonsense Mutation detected in F1 DNA Not yet available
sa19651 Nonsense Available for shipment Available now
sa39744 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19650
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 595 2244 13 21
Genomic Location (Zv9):
Chromosome 2 (position 1952320)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1807406
GRCz11 2 2150212
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGGCCGAGGACATCATTAAAGTCCACGAGGCTCGTCTGACCGAG[A/T]AAGAAACCTCTTCTCTTGACCTGAACGAAGTGGAAAAGTACTGCATGACT
Long Flanking Sequence:
ATGAGAGAGCTGGAGGGCAGCAGTGACCCTGAGCAGAGCCGATACCTGCGCGCAGAACTGGACCTGATCAACCAGAAACTGGGCAGCCTGCAGGGCTTCTCCAGCGCATACATCCAGAGGCAAGAACATTTATATAACAACCTGAAGTATCAGTGCTAGAAATGCATTGGCTCCTAGACACTGTAGATTAGGTTTCCTCTTGAAATGTAAATGGACCTTGATAAATAGCAGATTTTAAGGGGTTTGTATTGGCAGCGGGCGGCACGGTGGCTCATTTATTAAAAATGAGACTAAAAATAAATATGGGTTGTACAGATCATAATTTTTATCAATAGAGATTTGTAATCCGTTACACCACTAGAGAAATGTAATAGAGATAATAGAGAAATGTAACATGATGTTTGATGTCTGTTTTCAGGCTCGGTGCTCTACAAGCTCTGCTCCAGCACCTCCTGCAGGCCGAGGACATCATTAAAGTCCACGAGGCTCGTCTGACCGAG[A/T]AAGAAACCTCTTCTCTTGACCTGAACGAAGTGGAAAAGTACTGCATGACTCTCAAGGTGAAGTTCTTTGACATATCTAAAGTTTTTTTAAAGGCACAGTGTGTAATTTTGGCCACTAGAGGGCAGGTTTTAACAACACACATATGCATCGTTTGATGATTCCCTTACTGAGTGTGGAATCATGGGAGTTGTGGTCGTCAGTATCTTATGAGGCTCCTGGAGAAACCATGTTGATGGATGAGTAAAGTATTTAACACTTATTATCAGGGTAGTGTAGAGCAGAGTAAGAAAACGAGAGAAATGCAGAAGGAATTGCTGATGAGAGATGATGTTTGGTATTATGCTACAGTGCACCACTTCCTATCCTTACACTCGTGATCATGTGGAGAAGAAGCAGCGCTGTTTATTAGACTAAATACATGTTAGACTTCTGTTATAATGCTGCTCTGTGCAGTCGAATAAAACACACCGCATATATTTAATTAAGAGTGTGTGACGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30809
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 621 2244 14 21
Genomic Location (Zv9):
Chromosome 2 (position 1954635)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1809721
GRCz11 2 2152527
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTGAATCTGATGTCTTGTTTTCTGTAGACTATGAAAGCAGAGCTGGAG[C/T]AGAAGAAGGGTGTTTTGAAGGCGATGGAGACGGAGCTGTCTAAAGCTGTG
Long Flanking Sequence:
TCTTTTTGTGTTCGACAGAGTTGTTTAATACAAAAGAAGATATTTTGAATAATGTTGGAAACCTGTAACCATTGACTTGAATCTGCATTTGTTTTTTTCTACCATGGATGTCATTGGTTACAATTTTTCAGCTTTCCTAAAAATATCTTCTTTGTGTTTGACATAATTGTTTAATACAAAAGAAGATATTTTGAAAAATGCCGGAAACCTGTAACCATTGACTTTCATTGTTTTTGTTTTTTTCTTATATTGAAATCAATGGTTACAGGTTTCCAGCATTCTTCAAAATATCTTCTTTTAGTGTTCGACATAACCGTTTAACACAAAAGAAGATATTTTGAAAAATGTTGTAAACCTGTGACCATTGACTTCCATGGTTCCAGTAGACAGTGATTAATGTTAAGTGAACCACTATGAAAGCATGTCAAGTACTGTACACACAGTATTTGTAATTGAATCTGATGTCTTGTTTTCTGTAGACTATGAAAGCAGAGCTGGAG[C/T]AGAAGAAGGGTGTTTTGAAGGCGATGGAGACGGAGCTGTCTAAAGCTGTGCACTGGAACAGTCAGATTGACCAGTCTTTCCATCAGTGTGATGTTGACCTGTCCAGATACACTGAGCTGGTCGGACAGATGACTGACCGCTGGCGCAGGATTGTGACTCAGATTGATAGCAGGTACAGAGCACTTATTGCACTGGTCCTCAATCTGGTGTCCGGAATTCACATCTCCTCTTCAAGGAGGTCTTGGTATGCTTTTTTGGTCCGCTTTTGGTGCGCACTCGAGTATGATTGCTAGATTTTCACCTGCCCAAACGAACCGCACCAAGAAGGAGAGCGAACTCTAGTGCGATTCAACCGAACTAAATAAGGCAGGTGTGAAAGCACCCTTAGTAAGTGTAATACAAATACAAATTTACTCTATATATTAAACTCAATTGCATCTAATTAATCTGTAGTGAAAACTTTAGCAGCAATAAATCGATGATCATGAAAAATTGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13356
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 960 2244 19 21
Genomic Location (Zv9):
Chromosome 2 (position 1960075)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1815161
GRCz11 2 2157967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATGCGCAAGAGACAGAAAGAACTGGAGGAGCTCACTTTGTCCAAAAGT[C/T]AATTTGAAAGAGCCATCAAAGASAAAGAGCGRGAGATTGAACGGCTGAAA
Long Flanking Sequence:
TTTCCCCATTCAAAACTATACAAGTGACACATCTTGTGTATTCTGTAGTCTTCATTATTGTTACAGTTGGTTTATTGTCACTAACTACTGCTATTCCACTTTTTATTCAGATGCGGAACACCAAAATTGAGCTTTTGGAGGAGGAACTGAGACGCCTCAAGGACAACCTCAAAGATCAAAACCAGAAGAACAAATCACTGGAGGACAGTTTGACTCGCTTCCGCCTGGAGCTGACCCAGTCCAAAGAGCAGCTCATATCTATGGAGGAGGTGAAGAGAACCCAGGCCAGGCAGTGCAACACTGCTCAGGAAAGCCTGGATAGTACTCAGAACCAGCTGAAGAGTTTACAAGATGAGATGTCCCGCCTTACATTCCTCATCGAGGAGGAAAAGCGCAAGCGAAGGCTGGCCGAGGAGCGTTACACCAACCAGCAGGAGGAGTATGAGCTGGCCATGCGCAAGAGACAGAAAGAACTGGAGGAGCTCACTTTGTCCAAAAGT[C/T]AATTTGAAAGAGCCATCAAAGAGAAAGAGCGGGAGATTGAACGGCTGAAATTACAGCTGCAGGATGAGGCCTCCCGACGCTCGGCAGCAGAACTGGAGACCTCAAAGGTAAGAACCCAGTTGAACCAGGACATAAGTAGCCTAAAGCAAACATATGAATCTGAGATCCACGTCACCAAGACCACAGTGCTCAAGTCGGCACAGCAGAAGGATGAGGAATCGGCATCTCTGAGACTTCAGGTGGACAGGTTAACCTCTGAGAAGAGAGATCTGGAAGAGGAGCTAAGGAAACTGCAGCTTTCTTTCTCCCAGACGGAAGCGGCACGACGGAAAGCAGAAGAGGACGCGCATCAGAAGAGATCTATGGCTGCAGATGAAAGCAGATCCAAGAAGGAACTGGAGTCACAGATTCAGATCATAATTCGTCAAAGGGAAGACATTGAAACTAGACACAAGATGGACCTGGCTGATGCAAACAGAGTTGCTCAGGAAAAGACCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa302
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1197 2244 19 21
Genomic Location (Zv9):
Chromosome 2 (position 1960787)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1815873
GRCz11 2 2158679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCRTTATAAAGAGAGAGTTGGATGTACARAAAAGTGATAAGATGAAGT[T/A]GGAGCAGAATGCCACCAGGTTGCAGAGTCGCATAAATGAACTGCAGTCCA
Long Flanking Sequence:
TGAGGAATCGGCATCTCTGAGACTTCAGGTGGACAGGTTAACCTCTGAGAAGAGAGATCTGGAAGAGGAGCTAAGGAAACTGCAGCTTTCTTTCTCCCAGACGGAAGCGGCACGACGGAAAGCAGAAGAGGACGCGCATCAGAAGAGATCTATGGCTGCAGATGAAAGCAGATCCAAGAAGGAACTGGAGTCACAGATTCAGATCATAATTCGTCAAAGGGAAGACATTGAAACTAGACACAAGATGGACCTGGCTGATGCAAACAGAGTTGCTCAGGAAAAGACCCGTGAGATCACATTGCTGACGCAAAATTTGCAAGACGAGACCAGGCGGAGGAAAGCAATGGAGGTTGAGAATCAAAGCCTCAGACAGTCTCAGGCTGAAATACTAGCCAAGCAGACTTCAACCACAGAGGTCATCAACAAATTAAAGGTCTCTGAGCAAGAGGTTCTCATTATAAAGAGAGAGTTGGATGTACAGAAAAGTGATAAGATGAAGT[T/A]GGAGCAGAATGCCACCAGGTTGCAGAGTCGCATAAATGAACTGCAGTCCAAGGTGAACGAGTTGCAGGCTGAACTGGAGAAAGAGAGAAGGAATAATCAGGATGAGCTCACGAGGAGGAAACGCATGGAAACTGAGTTGGATAGGGTAAATCAGACGTGCCGTGAATACACCACTACCATCAGCACTCTGCGGGTCCAACAAGAGAAAGAAAGTTCTTCTGGACGGAGGTACGAGCAGGAGCTTCGCAGTGCAAAAGACGAGTTGGAGAGAAGCCTGAAAGAGTATAAAATCACAGTAGAGAATCTGACCAAAGTCAATGCAGAACTGAAGGCTTTGCAACAGCAGCTTGTACGGGAGCAGGGCCTGGTCCGAGAGGCTAATCAGCGAAATGATTCCCTCTACAAGACTATTGAGGAGAAGAGTCGACTACTAAATGAGAGCACTAGCGAGGTTGAAAAGTTGCAGACCCTCACCCAGAATCTTACCAAAGAGCGCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38306
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1293 2244 19 21
Genomic Location (Zv9):
Chromosome 2 (position 1961074)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1816160
GRCz11 2 2158966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTTCGCAGTGCAAAAGACGAGTTGGAGAGAAGCCTGAAAGAGTAT[A/T]AAATCACAGTAGAGAATCTGACCAAAGTCAATGCAGAACTGAAGGCTTTG
Long Flanking Sequence:
GTGAGATCACATTGCTGACGCAAAATTTGCAAGACGAGACCAGGCGGAGGAAAGCAATGGAGGTTGAGAATCAAAGCCTCAGACAGTCTCAGGCTGAAATACTAGCCAAGCAGACTTCAACCACAGAGGTCATCAACAAATTAAAGGTCTCTGAGCAAGAGGTTCTCATTATAAAGAGAGAGTTGGATGTACAGAAAAGTGATAAGATGAAGTTGGAGCAGAATGCCACCAGGTTGCAGAGTCGCATAAATGAACTGCAGTCCAAGGTGAACGAGTTGCAGGCTGAACTGGAGAAAGAGAGAAGGAATAATCAGGATGAGCTCACGAGGAGGAAACGCATGGAAACTGAGTTGGATAGGGTAAATCAGACGTGCCGTGAATACACCACTACCATCAGCACTCTGCGGGTCCAACAAGAGAAAGAAAGTTCTTCTGGACGGAGGTACGAGCAGGAGCTTCGCAGTGCAAAAGACGAGTTGGAGAGAAGCCTGAAAGAGTAT[A/T]AAATCACAGTAGAGAATCTGACCAAAGTCAATGCAGAACTGAAGGCTTTGCAACAGCAGCTTGTACGGGAGCAGGGCCTGGTCCGAGAGGCTAATCAGCGAAATGATTCCCTCTACAAGACTATTGAGGAGAAGAGTCGACTACTAAATGAGAGCACTAGCGAGGTTGAAAAGTTGCAGACCCTCACCCAGAATCTTACCAAAGAGCGCCTGCGACTTGAGGAGGAACTAAGGAATGTGCGGCTCGAGCGGGATGATGCTAAAAGAAGTCTGGGCACCATTGAGAGTGAAAGTGCTTCACGATTGTCTGCCATTCAGTTTCAGTTACAAACCAGCAATAACAGAGCAGTGGAACTGCAGGAGCTAATCAATGAACTGACAAAAGAGAGGGAAAGTTTAAGGGTGGAAATCGCCCAAATCCAAAAGCAGTTCTCAGAGGTATTTTATCCTGAGTGACACAAGCAATTTTCTTCTGTATCAGCTGAATCAAAAATACATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19651
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1882 2244 21 21
Genomic Location (Zv9):
Chromosome 2 (position 1963207)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1818293
GRCz11 2 2161099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTACCATCGAGAGTTAATCGACTATGACACCTTTCTGGAACTTTCCGAA[C/T]AAGAGTGCGAGTGGGAGGAGATCACGATTGAAACATCTGATGGAAACAAG
Long Flanking Sequence:
AGAAGGCTGTGACGGGATACAAAGATCCTGCAACAGGAAAGATCATCTCACTCTTCCAAGCTATTGAGAAAGAGATCATTGAGAAAGGCCATGGAATCAGACTGCTGGAAGCTCAGATAGCCAGCGGTGGGATTATTGATCCCAAAGGTAGCCATCGAATTGATGTGGAAGTAGCTTACAGGAAGGGTTACTTTGACCGTGAGATGAATGAGATTTTGTCCTATGAAGGGGATGACACCAAAGGTTTCTTTGATCCCAACACCCATGAAAACCTCACATATCTAGAGTTGAAAAAGAGGTGCATTAAAGATCCCAAGACTGGGCTCATGCTTTTGCCTTTAAATGACAAGCAGAAACCAAAGCAGACGACAACCCAGAAGAACACACTACGCAAAAGAAGAGTAGTGATCGTAGACCCTGACACTGGTAAAGAGATGACTGTACGAGAAGCGTACCATCGAGAGTTAATCGACTATGACACCTTTCTGGAACTTTCCGAA[C/T]AAGAGTGCGAGTGGGAGGAGATCACGATTGAAACATCTGATGGAAACAAGCGTTTACTTATTGTCGATCGCAAAACTGGAATCCAGTATGACATTCAGGAGTCCCTACAGAGGGGAATTATCAATAAACAAACTTTGGAAAAGTACCGTGCAGGGACTATGACGCTCACCGAGTTTGCAGCTCTGATCACTAGTAAAAGCAACAGCTCTGAGCTTGCCATCTTCTCCAGCAGTCCTGAGGATGTAGCCACCTGCAGCAGTCCCACACAGCCATCATCCCCAACCGTCCGCAAACGATTTGCAAGTGTTTCCATAACTCTATCCCCTCCATCTGATATTTTTGACGACCAGAGCCCTGTGGGAGCAATATTCGATACGGAGACCCTTGAGAAGATAACCATCCCCGAGGCTCAGCGACGTGGAATAGTGGACAACATCACCGCTCAGCGTCTTCTTGAAGCGCAGGTTTGCTCCGGAGGAATTATCAATCCCGCTACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39744
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1918 2244 21 21
Genomic Location (Zv9):
Chromosome 2 (position 1963315)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1818401
GRCz11 2 2161207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTGTCGATCGCAAAACTGGAATCCAGTATGACATTCAGGAGTCCCTA[C/T]AGAGGGGAATTATCAATAAACAAACTTTGGAAAAGTACCGTGCAGGGACT
Long Flanking Sequence:
AAGCTCAGATAGCCAGCGGTGGGATTATTGATCCCAAAGGTAGCCATCGAATTGATGTGGAAGTAGCTTACAGGAAGGGTTACTTTGACCGTGAGATGAATGAGATTTTGTCCTATGAAGGGGATGACACCAAAGGTTTCTTTGATCCCAACACCCATGAAAACCTCACATATCTAGAGTTGAAAAAGAGGTGCATTAAAGATCCCAAGACTGGGCTCATGCTTTTGCCTTTAAATGACAAGCAGAAACCAAAGCAGACGACAACCCAGAAGAACACACTACGCAAAAGAAGAGTAGTGATCGTAGACCCTGACACTGGTAAAGAGATGACTGTACGAGAAGCGTACCATCGAGAGTTAATCGACTATGACACCTTTCTGGAACTTTCCGAACAAGAGTGCGAGTGGGAGGAGATCACGATTGAAACATCTGATGGAAACAAGCGTTTACTTATTGTCGATCGCAAAACTGGAATCCAGTATGACATTCAGGAGTCCCTA[C/T]AGAGGGGAATTATCAATAAACAAACTTTGGAAAAGTACCGTGCAGGGACTATGACGCTCACCGAGTTTGCAGCTCTGATCACTAGTAAAAGCAACAGCTCTGAGCTTGCCATCTTCTCCAGCAGTCCTGAGGATGTAGCCACCTGCAGCAGTCCCACACAGCCATCATCCCCAACCGTCCGCAAACGATTTGCAAGTGTTTCCATAACTCTATCCCCTCCATCTGATATTTTTGACGACCAGAGCCCTGTGGGAGCAATATTCGATACGGAGACCCTTGAGAAGATAACCATCCCCGAGGCTCAGCGACGTGGAATAGTGGACAACATCACCGCTCAGCGTCTTCTTGAAGCGCAGGTTTGCTCCGGAGGAATTATCAATCCCGCTACAGGCCAGAGACTATCTCTGAAAGACGCCGTACAGCAAAGCCTCATCGATGAAGACATGAGCGTCAAGCTAAAACCAGCGCAGAAGGCTTATGACGGTTTTGAGGATGTGAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25734
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 2020 2244 21 21
Genomic Location (Zv9):
Chromosome 2 (position 1963621)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1818707
GRCz11 2 2161513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATATTCGATACGGAGACCCTTGAGAAGATAACCATCCCCGAGGCTCAG[C/T]GACGTGGAATAGTGGACAACATCACCGCTCAGCGTCTTCTTGAAGCGCAG
Long Flanking Sequence:
ACCCTGACACTGGTAAAGAGATGACTGTACGAGAAGCGTACCATCGAGAGTTAATCGACTATGACACCTTTCTGGAACTTTCCGAACAAGAGTGCGAGTGGGAGGAGATCACGATTGAAACATCTGATGGAAACAAGCGTTTACTTATTGTCGATCGCAAAACTGGAATCCAGTATGACATTCAGGAGTCCCTACAGAGGGGAATTATCAATAAACAAACTTTGGAAAAGTACCGTGCAGGGACTATGACGCTCACCGAGTTTGCAGCTCTGATCACTAGTAAAAGCAACAGCTCTGAGCTTGCCATCTTCTCCAGCAGTCCTGAGGATGTAGCCACCTGCAGCAGTCCCACACAGCCATCATCCCCAACCGTCCGCAAACGATTTGCAAGTGTTTCCATAACTCTATCCCCTCCATCTGATATTTTTGACGACCAGAGCCCTGTGGGAGCAATATTCGATACGGAGACCCTTGAGAAGATAACCATCCCCGAGGCTCAG[C/T]GACGTGGAATAGTGGACAACATCACCGCTCAGCGTCTTCTTGAAGCGCAGGTTTGCTCCGGAGGAATTATCAATCCCGCTACAGGCCAGAGACTATCTCTGAAAGACGCCGTACAGCAAAGCCTCATCGATGAAGACATGAGCGTCAAGCTAAAACCAGCGCAGAAGGCTTATGACGGTTTTGAGGATGTGAAGACCAAGAGGAAACTTTCTGCTGCCGAAGCCATGAAGGAAAAATGGTTGCCCTACGAAGCCGGCCAGAGGTTTCTAGAGTTCCAGTATCTCACAGGTGGACTCATAGAGCCAGGAACTGGACGCCGTGTCAGCATTGAGGAGGCCATCCGGAAAGGGTGGCTTGATGGCAAAGGTGCACAAAAGCTGCAAGATACCAGGAACTACATTAAGAACCTTACCTGTCCCAAAACCAAGCTTAAAATCTCATACAAAGAGGCGATGGATAACTGCATGGTGGAGGAGAACAATGGCATGAAGATGCTCCAG
Associated Phenotype:
Not determined