Busch Lab

ZMP

znf536

Ensembl ID:
ENSDARG00000022251
ZFIN ID:
ZDB-GENE-030616-624
Description:
Novel zinc finger protein [Source:UniProtKB/TrEMBL;Acc:Q1LYK4]
Human Orthologue:
ZNF536
Human Description:
zinc finger protein 536 [Source:HGNC Symbol;Acc:29025]
Mouse Orthologue:
Zfp536
Mouse Description:
zinc finger protein 536 Gene [Source:MGI Symbol;Acc:MGI:1926102]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa34159 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34160 Nonsense Mutation detected in F1 DNA Not yet available
sa18888 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2366
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068 Nonsense 38 1389 1 4
ENSDART00000126085 None None 610 None 3
Genomic Location (Zv9):
Chromosome 7 (position 47982102)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46100213
GRCz11 7 46372579
KASP Assay ID:
554-2923.1 (used for ordering genotyping assays)
KASP Sequence:
TTAGCAACGCAGTACTTAACGGCCGCTATCCAATCAGTCAGAAACTGCAT[C/T]AGCTGACTGCTCAGCTGGGTCATGCCTTTCCTGAACTACAGAGTCGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34159
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068 None 191 1389 1 4
ENSDART00000126085 Essential Splice Site 90 610 None 3
Genomic Location (Zv9):
Chromosome 7 (position 47982563)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46100674
GRCz11 7 46373040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGTAATCTGAAAATCCACCTCCGCACCCATAAGCTGGGAAATCTTGG[T/A]AAGGGCCGTGGTCGTGTACGTGAGGAAAATAGGCTTCTTCATGAACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34160
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068 Nonsense 293 1389 1 4
ENSDART00000126085 Nonsense 152 610 3 3
Genomic Location (Zv9):
Chromosome 7 (position 47982869)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46100980
GRCz11 7 46373346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGATGAGCAAGCCCTCAATCCAGCCCAAGGATACCGGTGCACTTTTTG[C/A]AAGGGTAAATTTAAGAAGCGCGAGGAGCTAGACCGCCACATTCGCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068 Nonsense 543 1389 1 4
ENSDART00000126085 Nonsense 402 610 3 3
Genomic Location (Zv9):
Chromosome 7 (position 47983619)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46101730
GRCz11 7 46374096
KASP Assay ID:
554-6151.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTTGCAAGCTGCAGCTAAGGTAGCAGAAATGGACCCCCTAAACAGTTA[T/A]CAAGCCTGGCAAATCATGGCACGTGGAATGGCAATGGAGCGCTCCTTCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5439
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068 Nonsense 1356 1389 3 4
ENSDART00000126085 None None 610 None 3
Genomic Location (Zv9):
Chromosome 7 (position 48041179)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46159290
GRCz11 7 46431656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCAGAGAACCTCGCAGCCTTCAACGGAGGTCTTGGTGGAAGCTCCAAY[G/T]GAGGAAGCGGTGGCACCAGCAACATGAAAAGAAACGACCCCTCTGGTGAG
Associated Phenotype:
Not determined