Busch Lab

ZMP

v2ra1

Ensembl ID:
ENSDARG00000022229
ZFIN ID:
ZDB-GENE-050419-156
Description:
Novel protein similar to vertebrate pheremone receptor [Source:UniProtKB/TrEMBL;Acc:A3KQL3]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31618 Nonsense Available for shipment Available now
sa34237 Nonsense Mutation detected in F1 DNA Not yet available
sa41080 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21144 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31618
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Nonsense 137 837 2 6
Genomic Location (Zv9):
Chromosome 7 (position 71862299)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32474730
GRCz11 18 32445186
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCATTGATGAATGTTCAAGAATTTGCATCAAGAGGTAGCTGCAATGGA[C/T]AGTCTCCAGTACATGCTATCATAGGTGAAACAGAGTCTTCCAATACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34237
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Nonsense 356 837 3 6
Genomic Location (Zv9):
Chromosome 7 (position 71863036)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32475467
GRCz11 18 32445923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGGAAACAGCTTTTCCATGCTCACAGACTTCACAGAAAGAAAATTCT[C/T]AATATAAATTAATTTGCAACATATATCGAGATCTTCTTGTACTGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41080
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Essential Splice Site 419 837 3 6
Genomic Location (Zv9):
Chromosome 7 (position 71863228)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32475659
GRCz11 18 32446115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGAGAAAATGGAGCATGTGAAACAGACATGAAAATACAACCTCAGCAG[G/A]TAATAAACAAAAACAATGAATGAATGTTAGGAAGTTAGAGCGCAAGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Nonsense 711 837 6 6
Genomic Location (Zv9):
Chromosome 7 (position 71865991)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32478422
GRCz11 18 32448878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTCTTATCTGTGTGCTTTGGCTAGCAGTATCTCCTCCATTGCCCTAC[A/T]AAAATACGAAATATTTCAAAGAAAAAATTATTCTTGAGTGCAGTCTGGGT
Associated Phenotype:
Not determined