Busch Lab

ZMP

si:ch211-198d18.2

Ensembl ID:
ENSDARG00000022187
ZFIN ID:
ZDB-GENE-041210-192
Description:
hypothetical protein LOC561983 [Source:RefSeq peptide;Acc:NP_001124071]
Human Orthologue:
USP6NL
Human Description:
USP6 N-terminal like [Source:HGNC Symbol;Acc:16858]
Mouse Orthologue:
Usp6nl
Mouse Description:
USP6 N-terminal like Gene [Source:MGI Symbol;Acc:MGI:2138893]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa16612 Essential Splice Site Available for shipment Available now
sa44590 Nonsense Mutation detected in F1 DNA Not yet available
sa45177 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33468 Nonsense Mutation detected in F1 DNA Not yet available
sa20282 Nonsense Available for shipment Available now
sa40300 Nonsense Mutation detected in F1 DNA Not yet available
sa38440 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 Essential Splice Site 25 405 None 13
ENSDART00000100391 None None 747 None 14
ENSDART00000123199 Essential Splice Site 26 827 None 14
ENSDART00000143571 Essential Splice Site 43 423 None 14
Genomic Location (Zv9):
Chromosome 4 (position 22750244)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24093579
GRCz11 4 23814554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGAAGTTGGAACAGGAGCGAGCTGAGATACTCGYMAAATATGATAAGG[T/G]GAGAGAAGACAGCTKATRTTCATTTATGAGCWAACACCCYTCCAAAACWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44590
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 None None 405 None 13
ENSDART00000100391 None None 747 4 14
ENSDART00000123199 Nonsense 60 827 4 14
ENSDART00000143571 None None 423 None 14
Genomic Location (Zv9):
Chromosome 4 (position 22737855)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24081190
GRCz11 4 23802165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATAATCTAATGTGTTTTGTCTTTTTACAGTGAGGGTGAGCTTGTGTA[T/A]GACATAGTGGAGGAAAAGGTGAGTCTAGTTCTGTGCTTGTGTTTGTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45177
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 Essential Splice Site 90 405 4 13
ENSDART00000100391 Essential Splice Site 13 747 5 14
ENSDART00000123199 Essential Splice Site 93 827 5 14
ENSDART00000143571 Essential Splice Site 108 423 5 14
Genomic Location (Zv9):
Chromosome 4 (position 22736479)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24079814
GRCz11 4 23800789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGCTGAAAATGTTGAAGAGCTGGGAGAAATACAAGAACAGCGACAAG[G/A]TACGTGTCCTTCATAAACACATGGCAACTCTCTGAAGGACTTGGAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33468
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 Nonsense 249 405 9 13
ENSDART00000100391 Nonsense 172 747 10 14
ENSDART00000123199 Nonsense 252 827 10 14
ENSDART00000143571 Nonsense 267 423 10 14
Genomic Location (Zv9):
Chromosome 4 (position 22720062)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24063397
GRCz11 4 23784372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGGAGCATCATGATCGTATTCTGCAGAAGATGATGCCTAAACTTAAA[C/T]AACATCTAGTAAGACGCATTAACATCTCCAGAACATCACATCACACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20282
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 Nonsense 286 405 11 13
ENSDART00000100391 Nonsense 209 747 12 14
ENSDART00000123199 Nonsense 289 827 12 14
ENSDART00000143571 Nonsense 304 423 12 14
Genomic Location (Zv9):
Chromosome 4 (position 22716736)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24060071
GRCz11 4 23781046
KASP Assay ID:
2259-4954.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGAATAGACTCCATTCACGCTGACACTGAGAATATGGGACATTTA[T/A]ATTCTGGAAGGAGAGCGAGTCCTGACTGCAATGTCTTACACCATCCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40300
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 None None 405 13 13
ENSDART00000100391 Nonsense 336 747 14 14
ENSDART00000123199 Nonsense 416 827 14 14
ENSDART00000143571 None None 423 None 14
Genomic Location (Zv9):
Chromosome 4 (position 22711625)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24054960
GRCz11 4 23775935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGGGTCTCCCCCCTCGTGGTCCAAGCCCTGCCGTAAGTGTCAATAAA[C/T]GAGTAGACTCTGGTCCCGTCACCGATGGCACACCCGAGAGGTACCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38440
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 None None 405 13 13
ENSDART00000100391 Nonsense 545 747 14 14
ENSDART00000123199 Nonsense 625 827 14 14
ENSDART00000143571 None None 423 None 14
Genomic Location (Zv9):
Chromosome 4 (position 22710997)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24054332
GRCz11 4 23775307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCCCCAAGCAGAGCATGATGCAGTCCAAACCAGAACCCCGTGCCCCTT[T/A]GCACTACCCACCTGGCATGACGCCTGTCTACACTCCCTACATTTCAGAAA
Associated Phenotype:
Not determined