Busch Lab

ZMP

cdkal1

Ensembl ID:
ENSDARG00000022122
ZFIN ID:
ZDB-GENE-040426-1443
Description:
CDK5 regulatory subunit-associated protein 1-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PG34]
Human Orthologue:
CDKAL1
Human Description:
CDK5 regulatory subunit associated protein 1-like 1 [Source:HGNC Symbol;Acc:21050]
Mouse Orthologue:
Cdkal1
Mouse Description:
CDK5 regulatory subunit associated protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1921765]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42636 Nonsense Mutation detected in F1 DNA Not yet available
sa36008 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42636
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029313 Nonsense 345 407 17 18
Genomic Location (Zv9):
Chromosome 16 (position 89571)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14085
GRCz11 16 52116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGGTCCAGGTGGAGGTGTACGAGTGCGGGAAACACTACATGAAGGGC[C/T]GACCACTGGAGGAGGCGCCACTGCGCACCGCATACACCACTGCACCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36008
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029313 Nonsense 378 407 18 18
Genomic Location (Zv9):
Chromosome 16 (position 90220)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14734
GRCz11 16 52765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGTGTTCCTCATCTTGATCTTGTGTTCAGGCCGGTGTGTGTGAGCCG[C/T]AGTGCTGGATGCCGGACGGGATGAGGATTCTGGCTGTGGTTCTGCTTCTG
Associated Phenotype:
Not determined