Busch Lab

ZMP

si:dkey-34e4.1

Ensembl ID:
ENSDARG00000022085
ZFIN ID:
ZDB-GENE-070705-456
Description:
Novel protein similar to vertebrate nitric oxide synthase 1 (Neuronal) adaptor protein (NOS1AP) [Sou
Human Orthologues:
NOS1AP, RP11-565P22.6
Human Description:
nitric oxide synthase 1 (neuronal) adaptor protein [Source:HGNC Symbol;Acc:16859]
Mouse Orthologue:
Nos1ap
Mouse Description:
nitric oxide synthase 1 (neuronal) adaptor protein Gene [Source:MGI Symbol;Acc:MGI:1917979]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40482 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048350 Nonsense 60 374 3 13
ENSDART00000137073 Nonsense 61 194 3 6
Genomic Location (Zv9):
Chromosome 5 (position 35192883)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32974832
GRCz11 5 33574985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAAAAATGTCTCATCATGCATTTAAAGCACTTTTTTTTTCTTGCAGTA[T/G]GAGTTCAAGGCAAAGAGTGTGAAGAAGAAGAAAGTGGCTATCGTGGTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3547
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048350 Nonsense 113 374 5 13
ENSDART00000137073 Nonsense 117 194 5 6
Genomic Location (Zv9):
Chromosome 5 (position 35192182)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32974131
GRCz11 5 33574284
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTATTCTCTTCTTTCCTATTTCCTATTTGTTTCCTCAAAGGATCTTCTA[T/A]GTATCGCATGATTCTCAGGATCTGAAGATTTTCAGCTACATTGCTCGWGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26515
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048350 Nonsense 300 374 12 13
ENSDART00000137073 None None 194 None 6
Genomic Location (Zv9):
Chromosome 5 (position 35179640)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32961589
GRCz11 5 33561742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTTCGCTCACACCGCTGGCCACCAAACACCACCTACAGCTTCTCCAA[C/T]AACAGCTTCTACAACAGCAGCAGCAAACACAGATCGCCGTTGCACAGGTA
Associated Phenotype:
Not determined