Busch Lab

ZMP

tlr4bb

Ensembl ID:
ENSDARG00000022048
ZFIN ID:
ZDB-GENE-040219-9
Description:
toll-like receptor 4b, duplicate b [Source:RefSeq peptide;Acc:NP_997978]
Human Orthologue:
TLR4
Human Description:
toll-like receptor 4 [Source:HGNC Symbol;Acc:11850]
Mouse Orthologue:
Tlr4
Mouse Description:
toll-like receptor 4 Gene [Source:MGI Symbol;Acc:MGI:96824]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa35456 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35457 Nonsense Mutation detected in F1 DNA Not yet available
sa9527 Nonsense Available for shipment Available now
sa12965 Nonsense Available for shipment Available now
sa31917 Nonsense Available for shipment Available now
sa31918 Nonsense Available for shipment Available now
sa15774 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35456
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Essential Splice Site 30 819 2 3
Genomic Location (Zv9):
Chromosome 13 (position 18575292)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18395327
GRCz11 13 18526319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTATATGCAAATATAAAATATGTAAAACATGTCTTGGTCCTTTAATA[G/A]CTGATAAAGAATAAGGAATATTCATGTTCTGGAAGGAATCTGACTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35457
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 488 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18576750)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18396785
GRCz11 13 18527777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAAATGGCAGGAAACAGTTTTAGTGGAGATAAATTGAGTTACTTCTTA[C/T]AAAACCTAACAAGCTTGGAGGTTCTTGACATTTCACAGTGTGGCATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 518 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18576840)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18396875
GRCz11 13 18527867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGCATTGMGAAAGTCTCMATGAGATCTTTTACTGGCAYGCAGAAACTA[C/T]GACATTTATATTTMAGTCGAAACAAATTGATGGTTTTRRACTTTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12965
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 562 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18576973)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397008
GRCz11 13 18528000
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTGATAAAAACAGTATAACCACCATCCCACTTGATGTTCTACAAAAGY[T/A]GCCCATGAAYCTTTCTGAGTTTGATTTGTCCTCTAACTCCATCGATTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31917
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 588 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18577052)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397087
GRCz11 13 18528079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCTAACTCCATCGATTGCTCCTGCTCTCAGACTGATTTTATTTTGTG[G/A]ATTATTCAAAAACAAAACATTTTAAAACAACTGGAAAACATTCGGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31918
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 614 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18577128)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397163
GRCz11 13 18528155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAACTGGAAAACATTCGGTGTAAAACTTTTTCTGCAAATACAGATTTC[A/T]AAGCAATAGACTTTGACATTGACTACTGTGTGCACAAGAAAAGACTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15774
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 688 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18577351)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397386
GRCz11 13 18528378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAATGTTCTTATGACGCATTTGTGATTTTCTCCAGCTATGATGAAGCTT[G/A]GGTCRTGAATGAACTTATGGAGAATCTGGAGAACGGTGTGCCACCTATTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4498
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 811 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18577719)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397754
GRCz11 13 18528746
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATACCTGAAGTGGAGCAGAGACCCTTTGAGCAACATGAGATTCTGGATA[C/T]GACTCAGGAAAGCAATTTTACAGAAATAATCAATGCACTAAACATGTTTT
Associated Phenotype:
Not determined