Busch Lab

ZMP

KIAA1797

Ensembl ID:
ENSDARG00000022020
Description:
KIAA1797 [Source:HGNC Symbol;Acc:23377]
Human Orthologue:
KIAA1797
Human Description:
KIAA1797 [Source:HGNC Symbol;Acc:23377]
Mouse Orthologue:
BC057079
Mouse Description:
cDNA sequence BC057079 Gene [Source:MGI Symbol;Acc:MGI:2676921]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa26920 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40858 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20893 Essential Splice Site Available for shipment Available now
sa10081 Essential Splice Site Available for shipment Available now
sa18867 Nonsense Mutation detected in F1 DNA Not yet available
sa40859 Nonsense Mutation detected in F1 DNA Not yet available
sa34032 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34033 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26920
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 299 1797 10 49
Genomic Location (Zv9):
Chromosome 7 (position 20128283)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18661312
GRCz11 7 18913579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTCTCTGCTTCACACACTCCACCACATTATACCTGCACATGCAGAG[G/A]TGAATGCACACACACTGCAATAACAATGCTTTTCTTACTTCGATTTTTGA
Long Flanking Sequence:
CTATTGACTGATACTGTAATTCACTGACATAAATTAGTTGGGAAACATAATCGAGAAACATATATTAGTCTTTAATGTTGTGCTGTATTAGGATTTACAGCTAACATATATTGTGTTTTTCAAATATTATAGTTCAAACTAGTGCATTTTTTATTCTCACATGTTAGTCACTTTTTTATAAGTACATATGTTGAATAAATAATAGGTAATATTACATACAATCATTAAAAGATAATAATTAAAAATAAATTATTTCTGTCTCACACTTGTTTTTCTAAATTGTGCCCTGTCAGGTGGACAGTGTAACTGCAGTGGTGGAGTTGAGCTCGTTTGCCGAGTCTCTGACAGCGGCTCTGATCAGCCATCCAGAGCTCTGGAGGAAGGAACTGACCCGGCTGGCTCTCCAGCTCCTGTGTGCCTGTCAGCTCACAATTCATCTGGGAGGAGAGCTGATGTCTCTGCTTCACACACTCCACCACATTATACCTGCACATGCAGAG[G/A]TGAATGCACACACACTGCAATAACAATGCTTTTCTTACTTCGATTTTTGACATGTTCATTTAGTTTGGTTAGTACTGTAGTTGTTAGTACGTAAACACATGGCTCTCGGTGTTCACAGCAACCCAAATTCAATTCAATTAAAGGTGAAAACGCCCTTCTCGTATTTTGTGATTCACAACTGTTTTACATTTATTTACGGTTGCGAATTGCATTATGGGACCTTGATCTCTGCTCTGACAACTTTTGATGTTGCAAATTCAACTCTACAGTTTAACAAAGTGACTTTTATTGACATTTTAGTTGTTTGAAATAATTTAATGTATAAGAAATAGTATAGAGAGAAATAAGAAAATAGAGAGTCTGTAAAATAATAGAGTGTCTACTGGCAGTTTATTACAAGGTATTTGTAGTTTAACATACAACACCAACCCAGACAATATATGACTTTAAACTATTAAAAATTTTCATAAATGTCCCTTTATTAATTTTTCAAAGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40858
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 328 1797 11 49
Genomic Location (Zv9):
Chromosome 7 (position 20130266)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18663295
GRCz11 7 18915562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCCTGCTGAATGCCTCTGTCTCTCAGCAAACGGCGCTCCTAGATCTTG[G/A]TAAAACCCCTCTTGCTCTCTGAAGCCTTCATATTGACACGCCACGCTTCA
Long Flanking Sequence:
TCAACTGAGAATTTGGTTTAGAACAGTCACTGTCGTCTTTGTGCTTCCCCGTTTTCACTAACATTGCTGTAGTACAAAATAGAAATATGAAGTTGTACTAACTTATATGTAATATGTTTCCACAAATCAAAACATATTCTGTTTTACAGTTCTATCTAATTGCTTTCGTTAACAAAATGCCGATTAAAAAAGTGTTCGTTTTTTTTCTTCACAGGGAAGGGCAAAGTTATTATTATTATGTATTTGCTGCAGTTGTACTCTCTGTGTGATCTCTACAAATCTTCTCCTCTCATCTTTATAATGGTGTTGTTTGTGCAGCGTTGTCTATCTGAAAGCGATTTGCATTCAGCATTCCCTCTGCGACTCCATCTGTGTCAAAGCATTTGTCTGATTGTGCTCCATCTAATTGTAGGAACTCCCGGCTGAGCAAGTGATCATGGGAATCTCGCTGCTCCTGCTGAATGCCTCTGTCTCTCAGCAAACGGCGCTCCTAGATCTTG[G/A]TAAAACCCCTCTTGCTCTCTGAAGCCTTCATATTGACACGCCACGCTTCATTTACACAAAGGATGCCTAAAAAACAAGGAGTTTTTTTGTATCAAATTGTTTGATTTGCTATTATAATTTTTTTTATTGCAAAAACTGCTTTTGTTACTCAAGTAAAAATTATGTTTCCAGAAAATATGAATGTTCCTAAAACAAGCAAAAAATAAAGTAAATATCTGCCATTAAGATAAGCAAAAAATGATTGCTGCCTAAAATGTTTTAGTTGAATTAAATTAAAGATGCAGTATATAAGTTTGACTTGCAGTGGTTGAACTAGGAATTGCATTTCTGGATCAAAACAAACACAAGTGGAGGTTGCCAGATTGAGAACTAACAAGACTGATTTAAATCGTGTTCTTAATAAAAGCAACGGCATATGATAGAAGGAATATTTTACATATTGAAAGGAGTTTGTGTTCTAACCAGCACCTCGAATTGATATAATAGAGACAGCTTCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20893
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 518 1797 15 49
Genomic Location (Zv9):
Chromosome 7 (position 20150230)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18683259
GRCz11 7 18935526
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAG[G/A]TAAAGCCATTACGATGCACAACATGAACCATTAATCTCATAAGAGAATAC
Long Flanking Sequence:
TTTTCTGCGCGCATTGTTATTTATTTGGTAAAAAAATGTATCTTTTCATTTACACAAAAAAGCCACAATATTCTTAACTACGCTCCTCTTATTAGTTTGCTACAAGGGAATGATATACAAAAACAAAGGCCCGGCCCTTATCAATACTCTGTTTCAGAAGTACATCAATATATAAAATGATTTTTAGCAACTTTCAGTTCACGTAGACTTTAACATGGATAAAATATCATTTGGGAGGCAAAAAAATGCGATAACACGCAATACTGTAAATTTGTATAATTGTATAATTATATTTAAACTAATTTTTAATGAAAAATTAAATCTAAGAAAAGGAACTCCTAATGTTCTTAAATATGTGTTAATTGTTTGCTTAATTGTCTGATGTGCACCTCCAGGTTCCGTGTCTGCTCCCTGTGCTGATGTTCAAGCTCAGCAGAGTATCTGATCCAGCTCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAG[G/A]TAAAGCCATTACGATGCACAACATGAACCATTAATCTCATAAGAGAATACAGAAACTCAATCAATACATGTTTTTTCAGCAAATGTTTTCTGTTTTTGAATGTTTGTGTAAAGAAAGCAGATACATTTTTACGTAACCATTCTTTCGCTAAATAGTAGTTTACGGTTTACGGTTAATATTATTCTGTCATTTTTATCCAGAAAAAGATTTTGGGTGTTTCTTTTGATCACTTATCACTCATATTTTAGAAAACAATTTGAAGAGCAACAGAGTTTCTATGGGTCATGTAATTGTTTTATATTTTTTTTCTAAGTCATGGAATATCAGAAACTTTTGTTTGTGGCTTCAGAGTTTAATTTTCATTTATCAAAACGGCATTTTCTATATCGTGTAATGTTTTTTTGTCTCATTTTTTTCACATATTTTTTTTTTTTAGTAGTAAATATTATAAATTTATTCTTTTATTCTTTTCCTGCTCATCAGTTGGCAGTCACTTAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10081
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 518 1797 15 49
Genomic Location (Zv9):
Chromosome 7 (position 20150231)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18683260
GRCz11 7 18935527
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAGG[T/C]AAAGCCATTACGATGCACARCAYGAACCATTWATCTCATAAGWGAATACW
Long Flanking Sequence:
TTTCTGCGCGCATTGTTATTTATTTGGTAAAAAAATGTATCTTTTCATTTACACAAAAAAGCCACAATATTCTTAACTACGCTCCTCTTATTAGTTTGCTACAAGGGAATGATATACAAAAACAAAGGCCCGGCCCTTATCAATACTCTGTTTCAGAAGTACATCAATATATAAAATGATTTTTAGCAACTTTCAGTTCACGTAGACTTTAACATGGATAAAATATCATTTGGGAGGCAAAAAAATGCGATAACACGCAATACTGTAAATTTGTATAATTGTATAATTATATTTAAACTAATTTTTAATGAAAAATTAAATCTAAGAAAAGGAACTCCTAATGTTCTTAAATATGTGTTAATTGTTTGCTTAATTGTCTGATGTGCACCTCCAGGTTCCGTGTCTGCTCCCTGTGCTGATGTTCAAGCTCAGCAGAGTATCTGATCCAGCTCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAGG[T/C]AAAGCCATTACGATGCACAACATGAACCATTAATCTCATAAGAGAATACAGAAACTCAATCAATACATGTTTTTTCAGCAAATGTTTTCTGTTTTTGAATGTTTGTGTAAAGAAAGCAGATACATTTTTACGTAACCATTCTTTCGCTAAATAGTAGTTTACGGTTTACGGTTAATATTATTCTGTCATTTTTATCCAGAAAAAGATTTTGGGTGTTTCTTTTGATCACTTATCACTCATATTTTAGAAAACAATTTGAAGAGCAACAGAGTTTCTATGGGTCATGTAATTGTTTTATATTTTTTTTCTAAGTCATGGAATATCAGAAACTTTTGTTTGTGGCTTCAGAGTTTAATTTTCATTTATCAAAACGGCATTTTCTATATCGTGTAATGTTTTTTTGTCTCATTTTTTTCACATATTTTTTTTTTTTAGTAGTAAATATTATAAATTTATTCTTTTATTCTTTTCCTGCTCATCAGTTGGCAGTCACTTAGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26921
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 519 1797 16 49
Genomic Location (Zv9):
Chromosome 7 (position 20151253)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18684282
GRCz11 7 18936549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTATGTTTTAGGGTTATCATGATATGTGTCTTTTTTTCTTGCCTTTCA[G/A]TTGTGTATCCCGCAGGTGCTTCATGTTCTTCAGACTGTGGGCAGTTCATC
Long Flanking Sequence:
TGGTTAAATCATGCAAATATGCCAGGAATATGGATGTTAGACTATATGCTTCCAAATGTTCCAAAATCTGACTTAGATTATTCATTGTTGCTCTCATAATTGCTATTAAATTCAGAAAAAATAATATTGAAGCTCAAACTATTTAATATTATTATTATGCAAAACACAACATCGCTTTGTTTTTTCCCCATTCATAATAGGTAATGGAAATTCATATGCAATGAAAAACACTTTTAAAAAGCCCCAAAGTCTCAGAATGAACTAGTGCATGAAGAAGTTTTTTTTTAGCTTTCTCAAAATCTGTAAGATACTTTTATTTTTAGGAGCAGAATCTGTCCTGTCATTCACTGCTAAAGAATTAAAATCATTTAAGCATCGGTTAATGCATTATGCAAATAAAAGCATGTCTTAACTACGCGGGTTTGCATGTCTCCAGCTTTGTTCACCGGTCAGTATGTTTTAGGGTTATCATGATATGTGTCTTTTTTTCTTGCCTTTCA[G/A]TTGTGTATCCCGCAGGTGCTTCATGTTCTTCAGACTGTGGGCAGTTCATCTAGACTGAGGCCTGTGGCTCTGCGTCTCTTGGCTCTGCTGTGGAAAAAACAGGTGTGGTTTACTCTAAACTTTTTCTCTAAGGGGAGTCAGATGTCTGTGGCCATGATGCACTGCTTCATCATCAAAATCAGAAGCCACCCCAAATTCACTTGCGTTTATTATTATGCATATGCATTGTATTTGTAATATGAAACATGTTAAATCTTTTAAATCATCCGTGAAAATGCACTATTGATTAATATTTAATTGATATTATATGCAGTTGAACTCAGAATTTTTAGCCTCTCTGAATTATCAGCCCCATGTTTATTTTTTTCTCCAATTTCTGTTTAATGTAGAGAAGATTTGTTCAGCCATTTTTTCTCATATTAGTTTTAATAGCTCATTTCTGATAACTGATTTATTTGATCTTTGTCATAATTACAGGAAATAATATTTGACTATAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18867
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Nonsense 675 1797 19 49
Genomic Location (Zv9):
Chromosome 7 (position 20156781)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18689810
GRCz11 7 18942077
KASP Assay ID:
2259-8622.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGGTCCTGAAGGCCACAGCTGAACTTCTGGCATTAGTACCAGATT[T/A]AAATGTCAAAACAGAGGAATATGAGGCACGAGACCATCACCGTACTTTCT
Long Flanking Sequence:
ATTTTATGTGAACCAGTCATGACAGTATGGAACCGCCATCACAGATTTCCAGAACATCTCTGCACTGGTTTGATCTCATTCATTCTCTGTGTTTGCTATAATGTGCATTCTGTTCCAGGCCGTACCAGCATGGAGGAGACATGCTGGCTGCCATCAGAGACACACTGCTGCAGTTCTCCCGGAAAGACCAGGCCACCCCTGTGGCTCTGGCACTGCAGGCCTTACAGGAGCTCTGTAGAGCTGAGGTCAGTCTTCAGAGAGTCACACTGAACACATTCACATGCACACCAATCAGCTTATTGACAGGACATGTTTTTTTAGTGTACAGGCTAATCAATAAGGTAACACTGCATTAAACGTTTGCATTCTCCTTTCATATTTTTGGCTTCAGGTAGTTGATATCTGCTCTACATGGAAGGCTCTTTCTCCTAAGCTCCTCTCTGACACCAGACCGCTGGTCCTGAAGGCCACAGCTGAACTTCTGGCATTAGTACCAGATT[T/A]AAATGTCAAAACAGAGGAATATGAGGCACGAGACCATCACCGTACTTTCTCATTGCCATATATGTGTGGTATTTCTAGCTTCACATTTCATATACACTGCAGGACAAATGACTTCAAGCTTTATGTCCTTTTCCCCTACAGAAATTCGGAAGCGAGGCAGTGGGTGTTTTATGGGGCTACGCTCTTAGTCAGGTGAGTGCTGACATTTGCAAATGGTAATGAAGAGTAGGGATGGGCAGGACGGTTTACTAGTCATCCAACAATAGTTTCTAAAAGTCATTGTGCCGTTTTATGTGTCCGTGTATAGGTAGACATGTTTTAGTTGCTTCTCTGTGTCTAATTGTGGTTATTTGATTGGTTCAAAATTAGTTTGGCTCAAATACTGTAAAAGGGGAAGAAATAACCTGTAATACAAAGATGCTGTTTTAGCAAGAAAACTTGTCTTTTACTTTCACTTTCAAATTCGAGATGTTTTTGCTGGAGGTTGATATGTAAATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40859
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Nonsense 739 1797 22 49
Genomic Location (Zv9):
Chromosome 7 (position 20159911)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18692940
GRCz11 7 18945207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGGGATCTTGCTTTCAGGCTAGGCCCATACCCAAGCAACCTGAAGTC[G/T]AGGATGAAGTGAAGCAAAATGAGGAGGAGAATGAGGAGGAGGAAGATATT
Long Flanking Sequence:
TATTTCAAAATATTGCAAAATGTCTATTTACCTATTTATTTTCAAACTGTTAGATTACCAAAATGTGCACATATATTTAATTATATTAATTATAATTTTATATAAAGTACATGTTCATAATTGGCCATATATTAGGTTACTGTACTGGCCACAAAACAGACAATTAATAAATATAATCACAGTTATTTCTTAGACAATTAATCATCAGCCATTATAATCCTGACAGCCCAATATCTACTATACCTTTGCTAAAAAATAAATAAAAAAAACGGTATAATTTAAATTTTTTTTCTGGCTTTATCAGGACTCAGTGGTTGCAAGCCAGGGTTTTAAAGCTCTTTCTGAATACCCTGAATCATCTCACACCATTCTGCACTTACCAGAGCAGGTGAGAACATCTACAGAATGTCTTCGCATTGTTTTTGTGTTTTATTTATTGTATCTGTCTGTAATGGGGATCTTGCTTTCAGGCTAGGCCCATACCCAAGCAACCTGAAGTC[G/T]AGGATGAAGTGAAGCAAAATGAGGAGGAGAATGAGGAGGAGGAAGATATTTCAGTGCCAGGAGCATCATATGTGAAGCTCGTTTCTCTCACATCTTTATCTGTTTTACCAGGTATAAATAAAAGAATATATTGTGCATCAATTAATAGCGCTTTACTTTTTCCACATTTTTAGCAGCTTAATTGGAGTTAATCTGTGGTAAATTCAGTTGATTGGACATGATTTGAAAAGGCACACACCTGTGTATATAAGGTCTCAGGGTTGACAGTGCATGTCAAGCACAAACCAAGCATGAAGACAAAGGAATTGTCTGTAGACCTCAGAGACAGAATTGTGTTCAGGTACAAGGCTGGGGAAGGTTACAGAAAAATTTCTGCTGCTCTAAAAGTTGCAATGAGTGCCTCCATCATCATCTGTAAGTGGAAGATGATTGGAACCACCAGGACTCTTCCAAGAGCTGGCCGGCCATCTAAGTTGAGTGATCGGGGGAGGGCCTTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34032
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 1229 1797 33 49
Genomic Location (Zv9):
Chromosome 7 (position 20175534)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18708563
GRCz11 7 18960830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAAGCATGAACACTCTTCGCGCCCTGACCGAGGAAAGTCAACAGG[T/C]GAGAGAGACCTCGAACTGACTGTTTCACAACCAGTATCATACGCTAAGAT
Long Flanking Sequence:
TATTAATGAATGGTTTATTGGGACAGGACCATCTGAGAGTGCAAAAAAACATCTAAATGCTGAGAAAATCTGCATTAAAGTTAAATGCTTGGCAATGCACAATACTAATAAAAAATGTACCAAGTGAAATTTACACAATATCCTTATGGAGCTTGATTTTTTTTACTTAATATTCTAATGATTTTTGGCATCAAATAAAAATCATCAAATAAAGATCATTTTGATTTATAATGTATTTTTCCCCCTACTTCTAAAGAAATATACATGTCCTGCGTTAGGATAGTTTTGTGGTCTAATATTTAACAAAATATTTATATTTTTACAAAAGCCTCCATCTAAATTCATCCATTTCTTGTGTCTATTTTTGTCTGTATGTCAGGTTGTAGCCTATTCTGTGGCATGTGTGGGAGTTTCAGCATTTAGTGCAGGCATTATTGAGGCCAGTAAAGCAGAGGAAAGCATGAACACTCTTCGCGCCCTGACCGAGGAAAGTCAACAGG[T/C]GAGAGAGACCTCGAACTGACTGTTTCACAACCAGTATCATACGCTAAGATAAAATACTTTAGGATTTGACCTCTAGGTCAATTAGTTTGATCTTTCAACTAATGCCTTGTACATACACACACTTGCAGTCTTGGTCACTTGAGAGTGCTTGCATTCAGCAGAAAGTTTATATAAAGGTTATGGTATTTGATTAAGATTTGAGGGCATTTTTGATGTTCTGATAGCGAATCCTATGAATCACTTTCTATCCTGCATCGGAATTTCACGATTCATCAGTGGTGTCATGTGATGTCTTGAGAATGAAATAAATGGTGATTTTTTTTTTCATGGAAAACTTTTCTATACAAGTTAACTAATCACTGCAATGATATATACTGTAATATATTTTATTTCATAATTGCACTTCATATGCAAATAATTTGAAACAGCTTTTTATTACATAATTTAAGATGCATAAATGACTTCATGTCTATTTTTACTGTAAATAAAAGTTTTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34033
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Nonsense 1658 1797 46 49
Genomic Location (Zv9):
Chromosome 7 (position 20191285)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18727916
GRCz11 7 18980183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAATGGAGTGGCTGCTGGAGTTAATGGGCCACATCAGAAATGTGGCATA[T/A]GGATCTCCCTCTGTTAAATGTGTGGATGTTCTACAGGTATTTGCATTTCT
Long Flanking Sequence:
AGTTGTAAAAATGGCTTTTGCATTATTGGAATATATTCCTTTATTTTATTTGAATCAATTTCTTAATGATGAAATACAGTTGCAAATTTTTTTTTAACAAAATTGAAAAAGAAATGCAAATCCTGATACTAATATTCCAAAAAAAAAAAAATGACAATGTGTTAATTCATATCTAAGCTATTCTTGTTTCAAAAAATAACTTTAGTCTAATATAATTTGAATATATTGAATTGTTTTAAAAAGTAAAATACAAAGTGTATTAAAATTAAAAAGTTCTAATGGAAAAAAATATTAAATGAGCTATGAACTAAAATTATGTGTTTGTTAAACCAAAATATTTTATTTGGTTTTCCTGAAAAGTAAAATAATTATAAAAAAACTGTATGTTTCCTGTATTTACTGTATGTTTCAGAAAGTGAGGTGTTTTGTTTGTTCTCAGGGGTCTCGAAACGAATGGAGTGGCTGCTGGAGTTAATGGGCCACATCAGAAATGTGGCATA[T/A]GGATCTCCCTCTGTTAAATGTGTGGATGTTCTACAGGTATTTGCATTTCTTTACCCTCACTTTACAATCAGATGTGAGTGTGTCTATCTGAAGTGCAGTTACTGCTCTCTGAAAAGCATTTCTCTATACTTAAAGGTCTCATGAAGTGCTTTGAAATGTGTTATTTTATTTAAAGTTGACGTAATCTAAAACATGGAGGGTGGGACATAGAGTAGCTTCTCCCCCTTTTTCGAAAACAGCCAAGATAATTTTGTTTTTATCACAGCTCTGCCAGTGAGAGTGGTTGAGCAAATAAGAAGCTTTCTGAAGGAGGCAGAACATGTCAGATACTAGACTGCATTTGATTGGTTAGAAGATTTGACGAGAACCTGAAGTATGAGGTGATGTCAAATTATCTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGCAGGGCACAGATTTCCTCCTC
Associated Phenotype:
Not determined