Busch Lab

ZMP

zgc:66426

Ensembl ID:
ENSDARG00000022007
ZFIN ID:
ZDB-GENE-040426-1639
Description:
sperm flagellar protein 1 [Source:RefSeq peptide;Acc:NP_956821]
Human Orthologue:
SPEF1
Human Description:
sperm flagellar 1 [Source:HGNC Symbol;Acc:15874]
Mouse Orthologues:
6430531B16Rik, Spef1
Mouse Descriptions:
RIKEN cDNA 6430531B16 gene Gene [Source:MGI Symbol;Acc:MGI:2685939]
sperm flagellar 1 Gene [Source:MGI Symbol;Acc:MGI:3513546]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15680 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15680
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033090 Nonsense 109 231 3 7
ENSDART00000113981 Nonsense 110 232 3 7
ENSDART00000139854 Nonsense 100 225 3 7
Genomic Location (Zv9):
Chromosome 13 (position 24905060)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24550720
GRCz11 13 24681170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAATTGTAGTGAGCACACCAGGCTACAYTGAACCAGCCCTTTGCTCTT[T/A]GAGAGAGAAGATCGAGGAAAAGAAAGAAGGAAAACAACCAGATAGCGCAC
Long Flanking Sequence:
GAGTAGTCCATTCATTCATTCATTCATCCATTCATTTATTTTATATTCGGCTTGGTCCCTTTATTAATCTGGGGTCGCCACTGCAGAATGAACCACCAACTTATCCAGCATATGTTTCACGCAGCGCATACCCTTCCAGCTGCAACCCACCACTGGGAAACATGAGTAGTCTATATTTGGATATTTAGATTTTCACTAGATTTTCAATTTATCCTTGTTTTAACCAAGATGTCTACATGTGGAAATCTATTAGACATCTTTTCAATACATAATTATTTGGTAGGACTACAGTATATATTTTAAAACACGAATGAAGAAAACACAACGCTACATTTTTATATGTAATATCATTATTTAATTTAAATAATTTGCCCTCCTTTTTAAATCGTAAATTTTCTTTAGAAAAGTTTTCTCCAAGCTAAACTTCCATATACCTGAGGACACGGTGAAAAAAATTGTAGTGAGCACACCAGGCTACATTGAACCAGCCCTTTGCTCTT[T/A]GAGAGAGAAGATCGAGGAAAAGAAAGAAGGAAAACAACCAGATAGCGCACAGGTGAGAACTTTTATTTTTATTCTGCATCTTTCTGTATTATTTCCTCCTTTTCAGTCTGGCACTGAATTTAGTATTAACATGCAAGGTTTAGTCACACTGTCGAAGTTATGATCCTTTATAATTGTTTTTATAGGACTTGGAGTATTACACCACTTCAGATGGACAGCAGGGATCAGGTAGATGCTCTAAAACATATATTATGCATATAAATATGGCTCTTGCTTCCCAAGTAGAGTAGAGCAGGAAAGATAATTTAGAGGAGGTCTGACGTGGAGTTCATGTCCTGGTGAGCACCCCTGGACTGTGGTGTGTTTTAGTGGCAGACGCAGTAACTCGGGTTTTAAGTTAAGCTTCATTTATTTTTATAAAAGTCTCTCCACTATTGAATATGCCTTAGTTTGTAACTTAATGGGACAGTCTGCTTAACAATTCTGCCTTAACAATTCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28110
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033090 Nonsense 131 231 4 7
ENSDART00000113981 Nonsense 132 232 4 7
ENSDART00000139854 Nonsense 122 225 4 7
Genomic Location (Zv9):
Chromosome 13 (position 24905260)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24550920
GRCz11 13 24681370
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCGAAGTTATGATCCTTTATAATTGTTTTTATAGGACTTGGAGTATTA[C/A]ACCACTTCAGATGGACAGCAGGGATCAGGTAGATGCTCTAAAACATATAT
Long Flanking Sequence:
TTTTCAATTTATCCTTGTTTTAACCAAGATGTCTACATGTGGAAATCTATTAGACATCTTTTCAATACATAATTATTTGGTAGGACTACAGTATATATTTTAAAACACGAATGAAGAAAACACAACGCTACATTTTTATATGTAATATCATTATTTAATTTAAATAATTTGCCCTCCTTTTTAAATCGTAAATTTTCTTTAGAAAAGTTTTCTCCAAGCTAAACTTCCATATACCTGAGGACACGGTGAAAAAAATTGTAGTGAGCACACCAGGCTACATTGAACCAGCCCTTTGCTCTTTGAGAGAGAAGATCGAGGAAAAGAAAGAAGGAAAACAACCAGATAGCGCACAGGTGAGAACTTTTATTTTTATTCTGCATCTTTCTGTATTATTTCCTCCTTTTCAGTCTGGCACTGAATTTAGTATTAACATGCAAGGTTTAGTCACACTGTCGAAGTTATGATCCTTTATAATTGTTTTTATAGGACTTGGAGTATTA[C/A]ACCACTTCAGATGGACAGCAGGGATCAGGTAGATGCTCTAAAACATATATTATGCATATAAATATGGCTCTTGCTTCCCAAGTAGAGTAGAGCAGGAAAGATAATTTAGAGGAGGTCTGACGTGGAGTTCATGTCCTGGTGAGCACCCCTGGACTGTGGTGTGTTTTAGTGGCAGACGCAGTAACTCGGGTTTTAAGTTAAGCTTCATTTATTTTTATAAAAGTCTCTCCACTATTGAATATGCCTTAGTTTGTAACTTAATGGGACAGTCTGCTTAACAATTCTGCCTTAACAATTCTGCTCAGTCGGTAGAGCGTGCGACTCTTAATCTCAGGGTCGTGGGTTCGAGCCCCACATTGGCCGTTTCTGTGACCTTTAGGCGAGGCAGTGGCGCAGTAGGTAGTGCTGTTGCCTCACAGCAAGAAGGTCGCTGGGTCGCTGGTTCGAACCTCGGCTCAGTTGGCGTTTCTGTGTGGAGTTCTCCCTGCCTTCACGTGGGT
Associated Phenotype:
Not determined