Busch Lab

ZMP

zgc:171797

Ensembl ID:
ENSDARG00000022001
ZFIN ID:
ZDB-GENE-071004-97
Description:
hypothetical protein LOC560386 [Source:RefSeq peptide;Acc:NP_001103498]
Human Orthologue:
CNOT6
Human Description:
CCR4-NOT transcription complex, subunit 6 [Source:HGNC Symbol;Acc:14099]
Mouse Orthologue:
Cnot6
Mouse Description:
CCR4-NOT transcription complex, subunit 6 Gene [Source:MGI Symbol;Acc:MGI:2144529]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22556 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22556
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030357 Nonsense 231 558 7 12
Genomic Location (Zv9):
Chromosome 14 (position 52645276)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49764473
GRCz11 14 48752230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAACTGGAGCTACAGGAAAAAGTCCATCATGCAGGAGATCCTCAACTG[C/A]AATGCAGACATCATCAGCTTACAGGTAAACGATTGTGTAAGCCTGGCATA
Long Flanking Sequence:
ATTTATGAGATTTTGGCCTTTGGGTTTAATAAATCAAGTAATTTTAATGTGTTTCTATCAGTATTTTAACAACAGTAAATAGTTTTAACATGGAACATTTAACGATTATGATTCAGTGTTCATTCTTAATTGGAGTTCAGCTTTTATTCTTATAGTTAAAAGAAAAATGATTAAGTTTCTTACAGCTGTTGTTCTGTAATGTAATGTCTTCTCAGTCCCAACAGAGCAGCCTCCGCCCCGCTCCTGGATTGTGCTGCAGGAGCCTGAAAGATCAAGACCAACAGGTAGAAGCTTCTTTCAAACACTGAAACATAATGCAGAACACTTGAACACTCTGCATGATCATTCTCTCCCTTTGCTTCCGCAGCCCTGTTAACTGTAATGTGCTATAATGTGCTGTGTGATAAATACGCCACACGCCAGCTCTACGGCTACTGCCCATCCTGGGCTCTAAACTGGAGCTACAGGAAAAAGTCCATCATGCAGGAGATCCTCAACTG[C/A]AATGCAGACATCATCAGCTTACAGGTAAACGATTGTGTAAGCCTGGCATATTTTGATGATGCAGGACTTGTGGCGATTATTACAATATATGGGACTTTTGCAGAAATCATGTTTTATCATACTAAAGAGATTTTGGGCTTCTGTTATAATACTGCTCTGAGCAGTTGAATAAAACACAACATATTAACATTTCTTCATTTTTTATTTTAAAGAAAGTTTATTTTAGAAAAAGTGTATGGATACAAGTAGAGCTTGCTTGTTTTTACACTATTTAAAATATTTTGCTAAGAAATGTCTGAAATATTATTTTTCTTTATTATTCATTTATTATTGTATTAATACATTTATTTAATTATAATAATTTTTTTTTGAAAGGGCAAATTAATATATTTTACATCTGTGCTATTTGAAAAGTTCCTTATACATTAGCCCTTTATGAGTCAATTTCATTCATAATGGTCTTAAAAATGTCTTAAATTGAACTTGTTAAACCTGCAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8371
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030357 Nonsense 382 558 10 12
Genomic Location (Zv9):
Chromosome 14 (position 52650885)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49758864
GRCz11 14 48746621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCCAGAGTACTCTGACGTGAAGCTGGTGCAGACCATGATGTTCCTGTCA[G/T]AGGTGAAGAACATCATAGACAAAGCGTCTCGCAGTCTGAAGCACTCCTCA
Long Flanking Sequence:
GTAACCCTGAAATCTGTGTGTTCAAAAACATCTTAATATTGAGAAAATTCAGTTGTGAAGAAAATGTTGTACGTGGATCACTTAACAAATTGAGTTTTAATCTATTTATAGTAGGACATTTGCTATGTCTTCATGAAACATGAGTTTTACTTCTTTTTCTAATCATGACTGGCGTAAAATAAAAGTGCATAACTTTGGCCCCTGACAGCAGAGCATTTTTGCTTATTGCTAAAATTATACCCATGCAACATAACATTATACCATGTAACAAAATGGGTTTTGTCGTCCACATTTAATTGCTCCAGATGAAGGCAACATCGTTCATCTAACCATATTTTAGTGATGTATTACAATCCAGCCCTTTTTTTTCTTTTTATCCTGCAGCGGGTAAGTCAATCCATGCAATGGAGAAACAGCTCCTACTAGTGGCTAATGCTCACATGCACTGGGACCCAGAGTACTCTGACGTGAAGCTGGTGCAGACCATGATGTTCCTGTCA[G/T]AGGTGAAGAACATCATAGACAAAGCGTCTCGCAGTCTGAAGCACTCCTCAGTGTCTGGAGAAACCAGCAGCATCCCTCTGGTGCTGTGTGCCGACCTCAACTCACTACCTGACTCGGGTAAGACTTCATGTAGTGAATCACCCAAACCATCATTTTCATTGAATTTGATTAGAACTACAAACGTGGGTGAAAAGTGTAAATGAACTACAAACATGGGATGGGACCAACCATCAGGTAAAGATGTTTGTATAACTGTTAATTAATATTTAGCCAACTGGAAAATATTTAAATCGTGTTTTCTGTCTTGCATTTCATCTGCCACAACAATACTGAACTTATATCAAGACGTGTTCGGACATTAACATCTGAATGCATAATTATACAAAGACCTGAGGAGAATTCTCTGCATGAAAGGCACATGAATGGGAGAATAACCTGCTGCTTCTCTAATAAGTTAGGAAATTCAATGGGACAGAAATGTGGATGATGTGTAGATGATT
Associated Phenotype:
Not determined