Busch Lab

ZMP

si:ch211-241o7.3

Ensembl ID:
ENSDARG00000021982
ZFIN ID:
ZDB-GENE-091204-268
Human Orthologue:
SH3BP2
Human Description:
SH3-domain binding protein 2 [Source:HGNC Symbol;Acc:10825]
Mouse Orthologue:
Sh3bp2
Mouse Description:
SH3-domain binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1346349]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa9540 Nonsense Available for shipment Available now
sa34863 Nonsense Mutation detected in F1 DNA Not yet available
sa21687 Essential Splice Site Available for shipment Available now
sa14545 Nonsense Available for shipment Available now
sa21688 Nonsense Available for shipment Available now
sa11802 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2578
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Essential Splice Site 99 532 3 13
ENSDART00000137932 Essential Splice Site 80 494 2 11
Genomic Location (Zv9):
Chromosome 10 (position 15255618)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15268925
GRCz11 10 15227044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCACGTCTGCTGCACCACAAGGAACCTTTTCTCTCAACGGATACAACAG[G/A]TAGGCTGACTTACATAACACAATGCGTTCACTCACATGAAGTTCTAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9540
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Nonsense 127 532 4 13
ENSDART00000137932 Nonsense 108 494 3 11
Genomic Location (Zv9):
Chromosome 10 (position 15258321)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15271628
GRCz11 10 15229747
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGTTTTCCCTTTTAAGATCGTYCACTTCAGTAAGAGACACAGAACATG[G/A]TATTTCTCAGCTGCGAGTGAAGATGAGAGAAAGGTSAGRTTCTGCTGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27578
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Essential Splice Site 161 532 5 13
ENSDART00000137932 Essential Splice Site 142 494 4 11
Genomic Location (Zv9):
Chromosome 10 (position 15258538)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15271845
GRCz11 10 15229964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGAGAAATCAACTATTATAATGATAAAAAAGACATCCCACTTCCAAG[G/A]TACAATGTACTGTGCCATTTGCTCACATAGTGTTCAAAAAATCTGTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Nonsense 172 532 6 13
ENSDART00000137932 Nonsense 153 494 5 11
Genomic Location (Zv9):
Chromosome 10 (position 15260748)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15274055
GRCz11 10 15232174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCTTGTGTTTTTCATAGTGATGATTTGGATGCGGAGTCGTTATATGGA[C/T]AGCTGGAGGAAACGGTGGAAATCAGGCCTGTTGAAGAAGATCCTGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21687
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Essential Splice Site 188 532 6 13
ENSDART00000137932 Essential Splice Site 169 494 5 11
Genomic Location (Zv9):
Chromosome 10 (position 15260800)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15274107
GRCz11 10 15232226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGAGGAAACGGTGGAAATCAGGCCTGTTGAAGAAGATCCTGAAGAAG[G/T]TGTGCAGCATTTTACTTTATAATAATTGCACTTTAAACAATATTCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14545
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Nonsense 245 532 8 13
ENSDART00000137932 Nonsense 207 494 6 11
Genomic Location (Zv9):
Chromosome 10 (position 15263479)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15276786
GRCz11 10 15234905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAAACCCGATCGAAAGGACCTCCGCCTCCTCTACCACCTCCATTCAAG[A/T]AACCGTCCTGCCACATCAAAGATACTCCTCCTCCACCTCTACCGTATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21688
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Nonsense 414 532 9 13
ENSDART00000137932 Nonsense 376 494 7 11
Genomic Location (Zv9):
Chromosome 10 (position 15265607)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15278914
GRCz11 10 15237033
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAAACGAATTCCAGACAGAATTGATGAAAGCTCAGATGAAGAGGACTA[T/G]GAAAATGTGAGTTTCCTTCATTTGATATTTTGCAAACATATTTGATTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11802
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065012 Nonsense 418 532 10 13
ENSDART00000137932 Nonsense 380 494 8 11
Genomic Location (Zv9):
Chromosome 10 (position 15266311)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15279618
GRCz11 10 15237737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCTTTAACCAAATTTTGTCGTAACAACGTTGTCTTTTGTCATTAGGTA[C/T]AATTGCCTCCCTCTGTCTTTGTGAACACGATGGAAACCTGTAAYGTGGAA
Associated Phenotype:
Not determined