Busch Lab

ZMP

vax1

Ensembl ID:
ENSDARG00000021916
ZFIN ID:
ZDB-GENE-030904-9
Description:
Ventral anterior homeobox 1 [Source:UniProtKB/Swiss-Prot;Acc:Q801E0]
Human Orthologue:
VAX1
Human Description:
ventral anterior homeobox 1 [Source:HGNC Symbol;Acc:12660]
Mouse Orthologue:
Vax1
Mouse Description:
ventral anterior homeobox containing gene 1 Gene [Source:MGI Symbol;Acc:MGI:1277163]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42915 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4003
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031490 Essential Splice Site 73 317 1 3
Genomic Location (Zv9):
Chromosome 17 (position 21271029)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21421178
GRCz11 17 21441014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGCGAGCTCAGGAGATCCTGACTACTGCCGGAGGATTCTAGTTCGGGG[T/C]GAGTTTAAAAACACTCCTGGGAGCTTTCTGCACATTKTGCTCCCATCCCT
Long Flanking Sequence:
GTGAATGTTGCAAGGAGAGGAGCTGTTAAATTGCTGTTGAATTTGGGTGAGAAGTCTATGATCATTGGGCAAGTGAGTCTGCACAGAGATAATAGGGCAGATCAGTGGACTGGGCAAGTGCTGGTGGCACATTAGCTATCTGACTCTGATTCCAAGCTGCTGTTTTATAGAAAGACCAAACCTATATTACCCACAATAAGCAGTGTGTGTCCGTCCCCAAACAGTTATTTCTGCCCAACAAGGAGAAAAAGAAGGAGAACTCTTCGCAGAGGATACGAGACTATGGAAGTCCGCTACAGTCAAGACTCAGAGTCCGGAATGCTGCTGAAGAATGGACTAAAAGAGGGGAAAGAGGGAAAGGATTCCCAGGGGAGCATTTCAAAAACGTTCCTGAAGGACCAGCAGGAGTCCTTCTCTCCATCCGGAGCGGTGGAAAACTGTGAAAAGAGCCGGGCGAGCTCAGGAGATCCTGACTACTGCCGGAGGATTCTAGTTCGGGG[T/C]GAGTTTAAAAACACTCCTGGGAGCTTTCTGCACATTTTGCTCCCATCCCTCAAAAAATACTAATAAAATAAACAAGAAATCGATATAACAAGAACTTTTCATTTTGCTTTTTGTGTCAGTTTTAGTCGCTGGATTTTTATTATTTTTCCTCCATCGGCAAGTGTGTATAGATTTGAGTGTGCACAAGTGTAGATGATGCAAATTGATACAAACTAAGCTGATAACAGAAAAAAGTATGAATATTGTTGAAAAAAATAATACTTTAATTTTGCTCACTGTAATGGTGCAGTTAATGGCTTGATAATTAAAATAAAAATTTGTGCTACCTTTTGGTTAACGATAATTGTAAATGCTATTTAGACTAATTTCAGCTGTGCATTAAAATTATAAATGTTTTACATAAATGCTAAAATCTAATAATTAAAAATGATTGAAATTACTTTTGCATGATTATGGTTGTTTTTAAAAATTTTAGCTATGTAAGCAATACTTTACTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42915
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031490 Nonsense 122 317 2 3
Genomic Location (Zv9):
Chromosome 17 (position 21269097)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21419246
GRCz11 17 21439082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGACTGGAGATGGAGTTTCAGCGGTGTCAGTATGTTGTGGGACGGGAA[C/T]GAACTGAACTTGCCCGGCAACTTAACCTGTCTGAAACTCAGGTACACATT
Long Flanking Sequence:
TAGCATTTTTCTGCTTACAGATTTTTTGTAAGAGTATGTAATTTTTGTTTGTTAATAAAATAATATTGTACTAATCAGCATTTGTTTGGCATTTATATTGCAACAACAAAAACAGCATTCAGGCAGGACAAGGGTTTATTTAATAAAAACATCAAATGCTTTGGTTATTTAGCAATCGAAATTGTGCAATGTTTAATACGATTTGCATGACTACCAATATTAATTTCTCAAAAGAAAAAGCATTTTAGCATTTTTTAAAACTTATAACATATTCTGCTTATCTCAAGTAATTTTAATAATAGTCTTATAGCAGGTATGACAATTTTCTGAACACATTTTCCTCTTCACATGTAGATGCCAAAGGGTCGATTCGAGAAATTATTCTCCCCAAGGGTTTGGATCTAGACCGACCAAAGCGCACTAGGACCTCGTTCACAGCAGAGCAACTATACAGACTGGAGATGGAGTTTCAGCGGTGTCAGTATGTTGTGGGACGGGAA[C/T]GAACTGAACTTGCCCGGCAACTTAACCTGTCTGAAACTCAGGTACACATTCGAATGCAAATAGTGATACACAAACACTATTGCAAATACATTATAAAGACCACTGAAGACAGCCACTGCCATACAATTGCAAAATAATTAATTTGCCTCTCACAAATATGTCTTTCCACGTGACTCATGTCTGATGCACTAGCATAATTATTATTCAATGTATAAAGAAGTGCATTGCGGAGGCTCTTTACCAAAACACACAGAGCTACCTGAAAATAAAATGCACTTACTTCATGATATTAATATTTCATTTATTTGCATTTTGATCACCCTAAGGCAACCTAAAATATCAACAATCTGATCGCATTTTGTTGTTTCTGGACAATTCCCTTTTTCTGCCCTCTTCAGCAGTGCAATAGTTTGATGGTCTGTTAGTGGCATAAAGGCCCGCTTTACAAAAATAAGCCTAGTGATGCATTTGCGGCACATGCTTTGCACAGGGGTCAGTAA
Associated Phenotype:
Not determined