Busch Lab

ZMP

si:ch211-199m3.4

Ensembl ID:
ENSDARG00000021913
ZFIN ID:
ZDB-GENE-041014-334
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RH81]
Mouse Orthologue:
AC122332.1

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43482 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1572
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038535 Nonsense 167 1402 3 25
ENSDART00000135845 None None 538 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33741430)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33813943
GRCz11 20 33716822
KASP Assay ID:
554-1515.1 (used for ordering genotyping assays)
KASP Sequence:
ACGCAGATGCTGAATCTAAAAGAGGATGGATACTGGATATTCCCAGCAGC[A/T]GATCTCACCTGATCACCATTGAGGAAATCCATGGTGCTTTAACACCTGAA
Long Flanking Sequence:
TTTAGGTGAACTATCCCTTTAACTGTTAACAGGATCTTACTATAAAGGGCTACCAATATAATAATAATAATAAATTAATAAATAATATAATAATAATTAAAAATAATAAATTATATAATGCAATATATATGTATTTATCATATTTACTCTTATTAAACCCACACAAAGGGGATCATAGTATAAAAATATGTAAATAGCATGAATTAATAATGTGCCTTTTTTACAGCAATAGAGGTGACAGAAGATCACCCAGACGTTCAAGCTTTTGTGGAGGAAGCTATAAAGGAAGCAGCAGAGTCTCCAGCTCCACGGGAGCTTTATTTGGATGCTCTAGAGAAGCACATTAAAGAGGTAAACCATTGAATTCCTCTTCCTCAGCTCTCATACATACTTATAACAGCATTACTTCTGTTTAAGAGTGTTCTATGGGTTGATAGATTGAGGCTGAAGACGCAGATGCTGAATCTAAAAGAGGATGGATACTGGATATTCCCAGCAGC[A/T]GATCTCACCTGATCACCATTGAGGAAATCCATGGTGCTTTAACACCTGAAATCATATTCTGTCTCAAAGACAATGACAGAGAGGGTGAGAGAAAGTATTAGCAAAAACATAATGCATAATAGTCTAAGATTGTTTAATATACATCACACTTGTTGTTTATTAAAGGAAGGACTGTACTAACCAGAATGTACGAGCGGAATAAAGAAGAAGTGGATCAAGCTGTAATGACTCGCCTACAAAACCAAAGGAACCTGCAGAAGACACAAGACCATGAGACACTGTAAGTCTGGCTGATAGTACTTATGTTATTAAATACAGTGTATTTAAAGAAAATTTTGCTATTAGCATAACTGGAGTGAAAACTGAAATGAAAATGACATGCTACTGTTCAGGCAGCACCATGGCTCAGTGGTTAGCACTGTTGCCTCAAAGCAAGAAGGTTGCTGGTTCGAGCCCCAGCTGGAGCAGTTGGCATTTCTGTGTAGAGTTTGCATGTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038535 Essential Splice Site 275 1402 6 25
ENSDART00000135845 None None 538 None 10
Genomic Location (Zv9):
Chromosome 20 (position 33742821)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33815334
GRCz11 20 33718213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAAGTTCTGATAAGTCTGATGATGAAGGCAAAACTCCAAGCAAGAATG[G/A]TTTGCAGTTTTATCATCAATTATAGCTTTATGCTTTACTTGAGCATCATT
Long Flanking Sequence:
TAAATCTGACCTCAAACTTTGAATGATACATTTTAGGCTTTCCTAGTTTTTTTCAGGTTTAAGTTAAATTTTGATTCCCGAATGTATCTAAAAACATTTTTTTTGTACAGGATTTGGTGAACATTTGCATATTTTCATATTTAAAAAATATTTTAAACATGATTTTTTTTACATTTCTAAAAAAAAATTAAACATTTGTTTAAAAAAAATGGTATGCTTTTCCTCATTGCTTTCATGCTTGTTTGCAGGAAACACTCTGAGGACTCAAAGAAAGATTCACAGTATTCTGACACTCTGTCCAAACTAGAGACAGTGCATGAGGAGTCAGGTAACACCCATCATCACACTAACATCTACTAATTTTTACATTGCCAGTGGTCATTCTTATATTTTGATAGCATGATTGCTTTTTTTAATACATTTTGAAGTGCTTTTTCTATATATATTTGCAGAAAGTTCTGATAAGTCTGATGATGAAGGCAAAACTCCAAGCAAGAATG[G/A]TTTGCAGTTTTATCATCAATTATAGCTTTATGCTTTACTTGAGCATCATTTGTAGTTTCATGAGCTCTGGAAGATGTATATTTGTGCATATTTCTATGTTTCCAGAGGTGGTGCTGCCAACAGTGTGGGAAAACGGTCATCCTGATGGCCCAGAGATGGATGTCTTTAAAGTAGAGCTGAAGCAATTTGTGACAGATTGGGAAAGCATGGAGCAAACAATAACCTGCAGCTACGCTGTGCTGGAGATTAACAACAAAACCCCTCAGGGCATCCTCCAAGAGATGACTGATCATATGGAGAGTATGTCATTTTGACTGTTTCAAGATATTTTATTTAGCACCCACTTGGGGCTTTTGCACTGGAGGAACTTTTTCACAGATTTGCTAATCCAGTGACGTATGTAAAACGGGGTTGGAAGTGTGTGATTCCCACACAAAAATTGTGATTATAAAAAGCTACGTTGATGGGAGAATTTGAGCAGCTGTGTGTAAACTATAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29397
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038535 Nonsense 511 1402 10 25
ENSDART00000135845 None None 538 None 10
Genomic Location (Zv9):
Chromosome 20 (position 33746713)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33819226
GRCz11 20 33722105
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGAAAGACCCAGAAACGAGTGTCACCTGCTGATGATTCAGAACCACCC[G/T]AGGAACCTCCAGAGGAGCTGCAGAGCTTGCTTAAAGCTCAGGCCCGGATT
Long Flanking Sequence:
GAATGATTTTGAGATATTGAGATTCAAAGTTTTTGCATTCGATTATAGCAAACAGTATGCATAACATTTGTTTTTTTAAATAAAAAGTCTTAAAATGTAAACAACTTTTAAAAAAACATCCCATCATGTAAAAAAGTTGTCATTTAATAAGAATATGTCAATAACTAATTTCACAGGAACTTTAAAGTAATCTTTTCTGCAGCTTAAGTTGTTATTGGGATAATATTATATGCAATAAAAGCTTTAGCAAATAATTGCAACAAGAACATTTGATATCTTCATGTGCCTAAACTGTACATAAGACTAAGCTTGTTCACTACCAGCCACCTGCACTGCGGGTCTCCATGCTAGGAGTGAGGGGTTCTGGGAAGACGACTCATGGGAAGTGGCTTGCCCAGCAACTGGGAATTTTCCACATCCAGTTCAGAGAGCGTCTGCAAGAGCTCATTCAACGAAAGACCCAGAAACGAGTGTCACCTGCTGATGATTCAGAACCACCC[G/T]AGGAACCTCCAGAGGAGCTGCAGAGCTTGCTTAAAGCTCAGGCCCGGATTCAGAGTGCAGAATCACCTACAGACCAGGACAACACCACCAGTCTTGAGGAGACTGCATCTGGTAGTCCTGACGCAAAGGTAAAGGGGCTAAAAGGTTAGATGCTTGTATCATTGTTTATCATTGACTAATTTTGAGCGTTTATTCGTTTATAGGAAGAAGAAGCCTTGACCGAAGATGAAGAGGCCATTAAAGCATACTTGCAGAATGGAGATCCTCTCCCTTCAGAGATACTGGAAATGCTTTTATTTCAGTGGTGGAACCAGGAACCCTACAAGTAAACTTTCATTCACACACACTCATTAATTCACACATGCTAGCTCCTAATATTGAATAAAATACACTTGCAGATAATACATAAGTCATTATTTATTCACCTCAACATGAAGAAAATATTTAAAATACATTAAATTTCATATGGGGCAGCACGGTGGCTTAGTGGTTAGCACTGT
Associated Phenotype:
Not determined