Busch Lab

ZMP

b4galt7

Ensembl ID:
ENSDARG00000021899
ZFIN ID:
ZDB-GENE-040727-3
Description:
beta-1,4-galactosyltransferase 7 [Source:RefSeq peptide;Acc:NP_001003417]
Human Orthologue:
B4GALT7
Human Description:
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) [Source:HGNC
Mouse Orthologue:
B4galt7
Mouse Description:
xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) Gene [Source:M

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39001 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22486 Essential Splice Site Available for shipment Available now
sa35695 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39001
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037999 Essential Splice Site 203 317 3 6
Genomic Location (Zv9):
Chromosome 14 (position 27394538)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26087335
GRCz11 14 26385440
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGTATGTTGGAGGAATCCTGCTGCTCACTAAGAAACATTATCTGGCGG[T/C]AAGAAACCCAAAGTCTTTGGAACATTCTGGGATTTTCCGAATTTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037999 Essential Splice Site 231 317 4 6
Genomic Location (Zv9):
Chromosome 14 (position 27394370)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26087167
GRCz11 14 26385272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAGATGACGAGTTTTTCAGGAGACTGAAAGCAGCTAATCTTGAGG[T/G]ACATGATATAATCTAATCTAATCTAATATAATATAATATAATATAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35695
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037999 Nonsense 274 317 6 6
Genomic Location (Zv9):
Chromosome 14 (position 27391305)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26084102
GRCz11 14 26382207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTCAGCTTCTGTCTGCTTTTGGCAGGAGCAGTTTAAGGTGGACCCT[G/T]AGGGTGGCCTGAGTAACCTTCGCTACAAGGTGGAGTCCAGAAAAGAAGTG
Associated Phenotype:
Not determined