Busch Lab

ZMP

disc1

Ensembl ID:
ENSDARG00000021895
ZFIN IDs:
ZDB-GENE-090122-1, ZDB-GENE-090122-1
Description:
disrupted in schizophrenia 1 [Source:RefSeq peptide;Acc:NP_001135735]
Human Orthologue:
DISC1
Human Description:
disrupted in schizophrenia 1 [Source:HGNC Symbol;Acc:2888]
Mouse Orthologues:
AC168060.2, Disc1
Mouse Descriptions:
Disrupted in schizophrenia 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q811T9]
disrupted in schizophrenia 1 Gene [Source:MGI Symbol;Acc:MGI:2447658]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa17522 Essential Splice Site Available for shipment Available now
sa30671 Nonsense Mutation detected in F1 DNA Not yet available
sa42305 Nonsense Mutation detected in F1 DNA Not yet available
sa8625 Nonsense Mutation detected in F1 DNA Not yet available
sa294 Nonsense Confirmed mutation in F2 line Not yet available
sa42304 Nonsense Mutation detected in F1 DNA Not yet available
sa7379 Missense, Splice Site Mutation detected in F1 DNA Not yet available
sa35594 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17522
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Essential Splice Site 32 994 1 15
ENSDART00000121745 Essential Splice Site 32 994 1 15
Genomic Location (Zv9):
Chromosome 13 (position 50122988)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48854026
GRCz11 13 49144704
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAAAACTGACAYAGACTCTCCATGTCACCGGTGTGCTGTRAGGACAGG[T/A]AAGACAAAACTGCGATTATTGTTCATATGTACAACGAAATAGYGTGATAT
Long Flanking Sequence:
CGTCTGCTATGGCCTCTCTTTTCCTCTGGATATTAAAAATAACATGAAGAAAACACTCGAGACATCCTAAACAGACGGAAAAACGACGATCTTTCTTCAGGATTGCTTTGCGGAGTTTTTCCTCTCACAGGAAACTCGCCTTTTAAGTCTCATCGGTGACTTGAGGGGGTATTTTATTGAAGGGTTGATTAAGATTGTATAAATGACAACTTGCGGAATATCGGATGGAAAGCGTGAAGTTATAATTCAGATTTCTGTTGGAAAGTGAACGGCGTCCGGTGCACGCGCAAAAAGCGCACGCGCAGCCCAACGGAGGATGACCCGCGTCGCGTTTGGAGTTGAACTAAAGTAAAAAACTAAGTAAATAACCAAGTAGTTTCGGGGATTTACCAGTGTTAAACCACCATGATGTTCGCAGGAATGGTCAGGGTGGAAAACACCTCAAAAACGCTCAAAACTGACATAGACTCTCCATGTCACCGGTGTGCTGTGAGGACAGG[T/A]AAGACAAAACTGCGATTATTGTTCATATGTACAACGAAATAGTGTGATATTGTGTACAAGTGATTTATCGAAGTTGGAAACAATGATTAAATTTTCACTTCAGTTGTTTTGGATCCGTTTTTTTTACTTGACGTTTATTTGTACATTGATTTTACTAGCAATTTGCTAGCAATACTAGCAAGTTTTGAGCGGAATTAGTCTCAACAGTTATTTTTTTATTAACATTAAATCTAACAACATCAGAAAACCCTACTAAATATAACATTTGACATGATTTAATGCAATCATACACTGTTTATAGATAATTTTAGCATGATATTTAAAAAATAGATGTAAATGGTAGTCATTCACACACATGTTGTATATCTACATCCCTTGATCAGGGTTGGTTCAAATGCATTTTAAAATACAGTACCAAGTATCTTAATTTTGTGGTGTATCAAATTAAACCACAACATACAGCACTCACAATATGTATCAAAATAAAATATAGTATTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa247
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 139 994 2 15
ENSDART00000121745 Nonsense 139 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103805)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834843
GRCz11 13 49125521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCAGTGCAATCACGTGATGTTTTCAATTCCAGTTTCAGTTTCATTCAA[C/T]AGTCGCTAGACACTAGCGATTTATTAGATGTAAACACATGCTATTCACCC
Long Flanking Sequence:
TGTATTGCACGGATCACACTAATTTTATTGCTCAGTCACATGAATGCAGCTGTCATGGGTCATTATTTGTTTACAAAAATGCCATTGTGAAAGTTTGCATGTCGGATATCCAGCTATAAATTACTTCTCACAGTTGGTTATTGAGACTAAGAAGTTTAATCTGTAATCTGTGCTCAACAGGTGGTGTGAATCCTTCGGGAAACCACCGCAGGAGGAGCTTCAGACGGCCCGGATACATGCGGTCTGAGCCGATTAACCAGCTGGACGTTGCAGAAACATCATGTGATTCTGAACATCACAGAAGTCCTATTTCCAAGTCGCCTGCTGTGGAGAACACTCAAAAGAGTGCTTCAGAATTACTTGGCGAGAAATGGCTGACAGAGGGTTTCGAGAGAGACAACTCATCAAAGTCTTCAAATAAACACCATTTGCATGATGAGGAGGACAATTTACCAGTGCAATCACGTGATGTTTTCAATTCCAGTTTCAGTTTCATTCAA[C/T]AGTCGCTAGACACTAGCGATTTATTAGATGTAAACACATGCTATTCACCCAGAACTGAACACAAACAATCTGAATCAGCGTCAGGGCACCAGCTGAAGTCTAAAACTTCAAATTCAGGCTTTCTTAAACCTCCATCTGATTTAATGAATCACTTGAGCCAATCAGAAACCAGCATTGTTCAAATGAACCAATTAGAAACCAGAACTGTCCCGGTAAGCCAATCAAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAATCACTTAAGCCAATCGGAAACCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCCCCAAAAAGCCAATCAAACTCAGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTGACCCCACCAGAATCCAGCATTGTTTTAATGAACCAATCAGAAACCATAACTATTCCAATGAACCAAACAAAAAACAGCACCATCCCAGTGAGCCAATCAAATGCAGACTTTTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30671
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 230 994 2 15
ENSDART00000121745 Nonsense 230 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103532)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834570
GRCz11 13 49125248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAATCACTTAAGC[C/T]AATCGGAAACCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCC
Long Flanking Sequence:
AAACATCATGTGATTCTGAACATCACAGAAGTCCTATTTCCAAGTCGCCTGCTGTGGAGAACACTCAAAAGAGTGCTTCAGAATTACTTGGCGAGAAATGGCTGACAGAGGGTTTCGAGAGAGACAACTCATCAAAGTCTTCAAATAAACACCATTTGCATGATGAGGAGGACAATTTACCAGTGCAATCACGTGATGTTTTCAATTCCAGTTTCAGTTTCATTCAACAGTCGCTAGACACTAGCGATTTATTAGATGTAAACACATGCTATTCACCCAGAACTGAACACAAACAATCTGAATCAGCGTCAGGGCACCAGCTGAAGTCTAAAACTTCAAATTCAGGCTTTCTTAAACCTCCATCTGATTTAATGAATCACTTGAGCCAATCAGAAACCAGCATTGTTCAAATGAACCAATTAGAAACCAGAACTGTCCCGGTAAGCCAATCAAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAATCACTTAAGC[C/T]AATCGGAAACCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCCCCAAAAAGCCAATCAAACTCAGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTGACCCCACCAGAATCCAGCATTGTTTTAATGAACCAATCAGAAACCATAACTATTCCAATGAACCAAACAAAAAACAGCACCATCCCAGTGAGCCAATCAAATGCAGACTTTTTAAATCCTCCATCTGCTTTAATGAATCACTTGAACCAATCAGAAACTGTGCTTATTCCAATGAACCAATCAGAAACCAGCTCTATCCCAGTAAGCCAATCAAACTCAGGGTTTTTAAAACCTTCATCTAATTTAATAAATCACTTAAGCCAATCAGAATCAGTCACTGTTCCAATGAACCAATCAGAAACAAGCACGGTCTCATTAAGCCAATCAGAACCTGATTTTTTTTCTTTGAGACATTTGCCTTGTTCGATTGGTCAGTCGGCGCAGCAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42305
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 250 994 2 15
ENSDART00000121745 Nonsense 250 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103472)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834510
GRCz11 13 49125188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCCCCAAAAAGC[C/T]AATCAAACTCAGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTG
Long Flanking Sequence:
ACACTCAAAAGAGTGCTTCAGAATTACTTGGCGAGAAATGGCTGACAGAGGGTTTCGAGAGAGACAACTCATCAAAGTCTTCAAATAAACACCATTTGCATGATGAGGAGGACAATTTACCAGTGCAATCACGTGATGTTTTCAATTCCAGTTTCAGTTTCATTCAACAGTCGCTAGACACTAGCGATTTATTAGATGTAAACACATGCTATTCACCCAGAACTGAACACAAACAATCTGAATCAGCGTCAGGGCACCAGCTGAAGTCTAAAACTTCAAATTCAGGCTTTCTTAAACCTCCATCTGATTTAATGAATCACTTGAGCCAATCAGAAACCAGCATTGTTCAAATGAACCAATTAGAAACCAGAACTGTCCCGGTAAGCCAATCAAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAATCACTTAAGCCAATCGGAAACCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCCCCAAAAAGC[C/T]AATCAAACTCAGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTGACCCCACCAGAATCCAGCATTGTTTTAATGAACCAATCAGAAACCATAACTATTCCAATGAACCAAACAAAAAACAGCACCATCCCAGTGAGCCAATCAAATGCAGACTTTTTAAATCCTCCATCTGCTTTAATGAATCACTTGAACCAATCAGAAACTGTGCTTATTCCAATGAACCAATCAGAAACCAGCTCTATCCCAGTAAGCCAATCAAACTCAGGGTTTTTAAAACCTTCATCTAATTTAATAAATCACTTAAGCCAATCAGAATCAGTCACTGTTCCAATGAACCAATCAGAAACAAGCACGGTCTCATTAAGCCAATCAGAACCTGATTTTTTTTCTTTGAGACATTTGCCTTGTTCGATTGGTCAGTCGGCGCAGCAGAAAGGTCTGCTATTGGACCGAGAGCTGTGGTTGGTGGATCTGGACTTGCAGACCTCGTCCTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa198
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 275 994 2 15
ENSDART00000121745 Nonsense 275 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103396)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834434
GRCz11 13 49125112
KASP Assay ID:
554-0149.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTGATTTAATGAAACACTTGACCCCACCAGAATCCAGCATTGTTT[T/A]AATGAACCAATCAGAAACCATAACTATTCCAATGAACCAAACAAAAAACA
Long Flanking Sequence:
GTCTTCAAATAAACACCATTTGCATGATGAGGAGGACAATTTACCAGTGCAATCACGTGATGTTTTCAATTCCAGTTTCAGTTTCATTCAACAGTCGCTAGACACTAGCGATTTATTAGATGTAAACACATGCTATTCACCCAGAACTGAACACAAACAATCTGAATCAGCGTCAGGGCACCAGCTGAAGTCTAAAACTTCAAATTCAGGCTTTCTTAAACCTCCATCTGATTTAATGAATCACTTGAGCCAATCAGAAACCAGCATTGTTCAAATGAACCAATTAGAAACCAGAACTGTCCCGGTAAGCCAATCAAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAATCACTTAAGCCAATCGGAAACCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCCCCAAAAAGCCAATCAAACTCAGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTGACCCCACCAGAATCCAGCATTGTTT[T/A]AATGAACCAATCAGAAACCATAACTATTCCAATGAACCAAACAAAAAACAGCACCATCCCAGTGAGCCAATCAAATGCAGACTTTTTAAATCCTCCATCTGCTTTAATGAATCACTTGAACCAATCAGAAACTGTGCTTATTCCAATGAACCAATCAGAAACCAGCTCTATCCCAGTAAGCCAATCAAACTCAGGGTTTTTAAAACCTTCATCTAATTTAATAAATCACTTAAGCCAATCAGAATCAGTCACTGTTCCAATGAACCAATCAGAAACAAGCACGGTCTCATTAAGCCAATCAGAACCTGATTTTTTTTCTTTGAGACATTTGCCTTGTTCGATTGGTCAGTCGGCGCAGCAGAAAGGTCTGCTATTGGACCGAGAGCTGTGGTTGGTGGATCTGGACTTGCAGACCTCGTCCTCCATTATGTCTAAGTATACAAAAGAAAACATCCAGGATTCGGATTCTGGCTCTCTGGACGCTGAAATCACGTCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 310 994 2 15
ENSDART00000121745 Nonsense 310 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103291)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834329
GRCz11 13 49125007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCCCAGTGAGCCAATCAAATKCAGACTTTTTAAATCCTCCATCTGCTT[T/A]AATGAATCACTTGAACCAATCAGAAACTGTGCTTATTCCAATGAACCAAT
Long Flanking Sequence:
TAGCGATTTATTAGATGTAAACACATGCTATTCACCCAGAACTGAACACAAACAATCTGAATCAGCGTCAGGGCACCAGCTGAAGTCTAAAACTTCAAATTCAGGCTTTCTTAAACCTCCATCTGATTTAATGAATCACTTGAGCCAATCAGAAACCAGCATTGTTCAAATGAACCAATTAGAAACCAGAACTGTCCCGGTAAGCCAATCAAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAATCACTTAAGCCAATCGGAAACCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCCCCAAAAAGCCAATCAAACTCAGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTGACCCCACCAGAATCCAGCATTGTTTTAATGAACCAATCAGAAACCATAACTATTCCAATGAACCAAACAAAAAACAGCACCATCCCAGTGAGCCAATCAAATGCAGACTTTTTAAATCCTCCATCTGCTT[T/A]AATGAATCACTTGAACCAATCAGAAACTGTGCTTATTCCAATGAACCAATCAGAAACCAGCTCTATCCCAGTAAGCCAATCAAACTCAGGGTTTTTAAAACCTTCATCTAATTTAATAAATCACTTAAGCCAATCAGAATCAGTCACTGTTCCAATGAACCAATCAGAAACAAGCACGGTCTCATTAAGCCAATCAGAACCTGATTTTTTTTCTTTGAGACATTTGCCTTGTTCGATTGGTCAGTCGGCGCAGCAGAAAGGTCTGCTATTGGACCGAGAGCTGTGGTTGGTGGATCTGGACTTGCAGACCTCGTCCTCCATTATGTCTAAGTATACAAAAGAAAACATCCAGGATTCGGATTCTGGCTCTCTGGACGCTGAAATCACGTCTTCACACTCCATTGACTCTTCAGACTCGACTTCGTCTGGATATGAAAGCACCACACCGTCCTCAGATCAGAGTCAGGATGGTTTAATGAAGAAGTATGAGGATTTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa294
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 437 994 2 15
ENSDART00000121745 Nonsense 437 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50102911)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48833949
GRCz11 13 49124627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATACAAAAGAAAACATCCAGGATTCGGATTCTGGCTCTCTGGACGCT[G/T]AAATCACGTCTTCACACTCCATTGACTCTTCAGACTCGACTTCGTCTGGA
Long Flanking Sequence:
AATCCAGCATTGTTTTAATGAACCAATCAGAAACCATAACTATTCCAATGAACCAAACAAAAAACAGCACCATCCCAGTGAGCCAATCAAATGCAGACTTTTTAAATCCTCCATCTGCTTTAATGAATCACTTGAACCAATCAGAAACTGTGCTTATTCCAATGAACCAATCAGAAACCAGCTCTATCCCAGTAAGCCAATCAAACTCAGGGTTTTTAAAACCTTCATCTAATTTAATAAATCACTTAAGCCAATCAGAATCAGTCACTGTTCCAATGAACCAATCAGAAACAAGCACGGTCTCATTAAGCCAATCAGAACCTGATTTTTTTTCTTTGAGACATTTGCCTTGTTCGATTGGTCAGTCGGCGCAGCAGAAAGGTCTGCTATTGGACCGAGAGCTGTGGTTGGTGGATCTGGACTTGCAGACCTCGTCCTCCATTATGTCTAAGTATACAAAAGAAAACATCCAGGATTCGGATTCTGGCTCTCTGGACGCT[G/T]AAATCACGTCTTCACACTCCATTGACTCTTCAGACTCGACTTCGTCTGGATATGAAAGCACCACACCGTCCTCAGATCAGAGTCAGGATGGTTTAATGAAGAAGTATGAGGATTTTCTGCAAGACTGTCTGCAAAACAATCGCACAAACACCAAGGTGAGAACAACACAATAAATACTAGTTTTAAGTGAGGATCAAGTTTATCTTTACTTTCATACTGTAATATTTTTTTTTTATCAAAAATATATTTCTCAAATATAATTTACTTTTTTATTTTAAGATTTTTTTTTAATTCATTATAAATATAAAAAAAATTATAGCTGAATACAATTATTTATTAAGTGTTCCTATAAGAAATGTTCAATATCAGGGTTGTTATATACTCGCCGGCCACTTTATTAGGTACACCTGACTAGTGCTGGGTAGACACTCACTTTTGCCTCCAGAACAATATTTTATTTATTCATTCATTTTCTTGTCTGCTTAGTCCCTTTATTAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28203
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Essential Splice Site 563 994 4 15
ENSDART00000121745 Essential Splice Site 563 994 4 15
Genomic Location (Zv9):
Chromosome 13 (position 50092395)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48823433
GRCz11 13 49114111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGAACAGCAGTGAACAGCGCCATCCACAGGACAGACTCAGACTGCAGG[T/A]AGGAAAATATCACAATTATACTATACAAAGCTGCAGTAATTCAAGCAAAA
Long Flanking Sequence:
GTGTATACCTGCTGCAGGCCTTCCAGGAATGAGTTTGAGAAGCCCTGCTGTACAGTATTACTTTGTGATAAAAACTCATTCAGTGTGATTAATAAGCTTTTAGACAAATGAGGACGTCAGCAGTGTCTTCATATCTCACCACTTTCTTGTAATACCTGTGTCATTATACAGATTTGTGTCCTGATTTGTCACAAAAACATGTACACACAGACACACACACACACACACACACACACTTCCTGCAGTGTTAGATTTGTGTTTGTTATGTTATTGTTTATCCCATCAAATAAAAGCTGCCTTTCACATCAAATCAGATTTTTATGTATTTATTTTTTGTGTGTTTAGCTGAGCGTTTTGGTAAGAAACTGGAGGAACTGAGAAGAGAAAGAGCGACACTTAAGCCTGGACTTCCATCCAGACACCCTGAAGTCACTGGATATCTGGAGCGGCTCAGAACAGCAGTGAACAGCGCCATCCACAGGACAGACTCAGACTGCAGG[T/A]AGGAAAATATCACAATTATACTATACAAAGCTGCAGTAATTCAAGCAAAAAAATATGGTCAATTTGTGAAATATTATTACAGTTTAAAATAAGTGTCTTGTGTTGGAATAGATTTTAAAATGTCATTTATTCCTGTTATTCAAAGCTGAATTTTCTGCATCATTACTCCAGTCTTCAGTCATGAAATCATTCTAATAATCTGCAACTACACTACCTGACAAAAGTCCAGTTGTAAGAGCAACACATAATAACTTGACTTCTAGTTGATCATTTGGAAAAGTGGCAGAAGGTGGATTGTTCTGATGAATCATCTGTTGATGTGCATCCCAATCATCACAAATACTGCAGAAGACCTACTGGAACCAGCATGGAGCCGAGACTCTCACAGTTATCAGTCAAGTTTGGTGAAGGAAAAATCATGGTTTGGGTTTACATTCAGTATGGGGGCGTGCGAGAGATCTGCAGAGTGGATGATCAACATCAACAGCCTGAGGTATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42304
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 774 994 9 15
ENSDART00000121745 Nonsense 774 994 9 15
Genomic Location (Zv9):
Chromosome 13 (position 50080543)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48811581
GRCz11 13 49102259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGACCTGAGCCGCATGAAGGAGAAACACAAGCACATCAAGCTGGAGCTG[C/T]AGAACGGAGAAGCTCAGTATGGTGAGAAACACTCAACATTCACACACTTT
Long Flanking Sequence:
TTGATCCTCTTTGTGCCGTTTTGGTGACTGTCACTTTAAATTCAAATGAGTTTGTGCTCTTTTCAAAAGAGGGCGGAGCTACAGATGCATGTGTGTCAGCATAGCGGCAGATTCAAAACAAGACTAGCGTCCAATGCTAATGATGGAAAGATGGTGACTAGTGGGCGGGGCTTTCCCCCTCTGATGACACGTACAAAGGGAGAATGTCAATCAAAGTGTTTCTGCAGACTGTTTTAATCAAGTGTGATTATAAAAAATATAGTTCATTAATGTTTATCATTAGAAGCTGGTTATATTCACACACTGCTGACACACGACTGGCTTGTGCTTCAGGAAATGATTTCAGCAGTGCTAAAGAGCTTAAGGCGGAGATCAGGAGTGTGTACAGAGAGAGGGATCGTCTGGAGCTCCTGCATAGAAAGCTGCAGACTCTGAGCACAGGAAGTGGACTCGACCTGAGCCGCATGAAGGAGAAACACAAGCACATCAAGCTGGAGCTG[C/T]AGAACGGAGAAGCTCAGTATGGTGAGAAACACTCAACATTCACACACTTTTCAATCCTGACACACGGGGGAGCCGTTGAGCTGCAGATAAGGAGGGTTGCTCTTCTTCTGGGCCTCAGTGTTGGTTTATAAATAGAAAGAGAGATAGGATTTCTCAATTCCTTACAGCAGGGGTGTCCAAACTCGCTCCTGGAGGGCCGGTGTCCTGCAGAGTTTAGCTCCAACTTGCTTCAACACACCTGCCAGGAAGCTTTTAATATCTAGTAGGAGCTTGATTGGCTGGTTCAGGTGTGTTTGATTAGGGTTGAAGTTAAACTCTCCTGGATAGCGGCCCTCTAGGACTGGGTTTGGACACCCCTGCTTTACTGTAAAGTTTAAAAGGGATACAGCTGTGGATATGCACATTAGTATTGCATCATTTTTGTGACACTGTACAACAATAAGTGCTATTTTTACATTATTTTGAGGTTTGGATTTTTGATGCAAGCGTTAATAAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7379
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Splice Site None 994 None 15
ENSDART00000121745 Missense 937 994 14 15
Genomic Location (Zv9):
Chromosome 13 (position 50035691)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48766729
GRCz11 13 49057407
KASP Assay ID:
554-4369.1 (used for ordering genotyping assays)
KASP Sequence:
TGAATGAGTAGATGATGTTGTGATCAGATTTTCTTTAACTGAAAGCCACT[C/T]TCTCTGGAGAGGGAGGTCCWGGAGCTGAAGTCTGCTCTTCAGGCGATGCT
Long Flanking Sequence:
CTAGAATAAAAGCAGTTTTAAATCCATTTTAAAGTCAATGTTATTAGCCCCCTTAAGCAATATTTGTTTTGGATTGTCTCCAGAACAAACCACTGTTATACAATGACTTGCCTAATTGCCCTAACTTTACCCTAATTAACCTAGTTAAGCCTTTACATTTCACTTTTAGCTGTATAGAAGTGTCTTGAAAAATATCTAGTCAAATATTATTTACTGTCATCATGACAAAGATAAAATAAATCAGTTACTAGAAATGAGTCACAACTATTATGACTATTATGATTAGAAAACTATTATGATTAGAAATGTGTTGAAGAAATCTGCTCTTCGTTAAACAGAAATTGGGGAAAAACATATTCAGGGTGGTCTAATAATTCTGACTTCAACTGTAAATATCCCTATTCGACTTTTGTTCTCATTTTGAGTTCTTCCACTGGATTTGTTGGTGTGTGAATGAGTAGATGATGTTGTGATCAGATTTTCTTTAACTGAAAGCCACT[C/T]TCTCTGGAGAGGGAGGTCCTGGAGCTGAAGTCTGCTCTTCAGGCGATGCTGTCTCAGCTGAAGGAGGAAGATGAGGATGAAGAAGACGAAGAGAAATACTGTGATGTAGAAGAAGAACAGGTTGAAGATGAAGACCTGGAGGAGGAGCACTACTTCAGTGACAGCTGGGAAATCTGAACAGACTCCGTCACTAGCTATGTTTCCATCCACCTCTTTTTAATGCACACTTAAATTGGAATATTGCATAAAAAATGGGAACGCCTAGATGTTTTGATGTGCATGAAAACTGATGCGCACAAGTGAAGCTGCTGTCACACTAGACTTTTCTCCCCATAGACTTCCGTTCATACACAAGTGAATGTGGCAGACCAGAAACACAAGCTCATGCGACAAGTTTCTCAGTTCGCTGCGTTTGAAAGTTCAAGCTTAGTAAACTCTGACCTGCGAAATCGCATCACATGACTGCGTGAGACCAATCAAGGATCAAAACATGACCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35594
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 976 994 15 15
ENSDART00000121745 Nonsense 976 994 15 15
Genomic Location (Zv9):
Chromosome 13 (position 50035573)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48766611
GRCz11 13 49057289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGATGAGGATGAAGAAGACGAAGAGAAATACTGTGATGTAGAAGAAGAA[C/T]AGGTTGAAGATGAAGACCTGGAGGAGGAGCACTACTTCAGTGACAGCTGG
Long Flanking Sequence:
CCCTAACTTTACCCTAATTAACCTAGTTAAGCCTTTACATTTCACTTTTAGCTGTATAGAAGTGTCTTGAAAAATATCTAGTCAAATATTATTTACTGTCATCATGACAAAGATAAAATAAATCAGTTACTAGAAATGAGTCACAACTATTATGACTATTATGATTAGAAAACTATTATGATTAGAAATGTGTTGAAGAAATCTGCTCTTCGTTAAACAGAAATTGGGGAAAAACATATTCAGGGTGGTCTAATAATTCTGACTTCAACTGTAAATATCCCTATTCGACTTTTGTTCTCATTTTGAGTTCTTCCACTGGATTTGTTGGTGTGTGAATGAGTAGATGATGTTGTGATCAGATTTTCTTTAACTGAAAGCCACTCTCTCTGGAGAGGGAGGTCCTGGAGCTGAAGTCTGCTCTTCAGGCGATGCTGTCTCAGCTGAAGGAGGAAGATGAGGATGAAGAAGACGAAGAGAAATACTGTGATGTAGAAGAAGAA[C/T]AGGTTGAAGATGAAGACCTGGAGGAGGAGCACTACTTCAGTGACAGCTGGGAAATCTGAACAGACTCCGTCACTAGCTATGTTTCCATCCACCTCTTTTTAATGCACACTTAAATTGGAATATTGCATAAAAAATGGGAACGCCTAGATGTTTTGATGTGCATGAAAACTGATGCGCACAAGTGAAGCTGCTGTCACACTAGACTTTTCTCCCCATAGACTTCCGTTCATACACAAGTGAATGTGGCAGACCAGAAACACAAGCTCATGCGACAAGTTTCTCAGTTCGCTGCGTTTGAAAGTTCAAGCTTAGTAAACTCTGACCTGCGAAATCGCATCACATGACTGCGTGAGACCAATCAAGGATCAAAACATGACCTCTCTGGACAGAAATGTAAAATACGGAGCGATCACTAATTTTTTTATGTCTAATTATCATGTTTAATCCCGCCCTTTTTCGCAGTGTCGTACAAAATAATTTTGCATGCTTAAACTTAAGTG
Associated Phenotype:
Not determined