Busch Lab

ZMP

zgc:56194

Ensembl ID:
ENSDARG00000021859
ZFIN ID:
ZDB-GENE-040426-934
Description:
Novel protein similar to vertebrate type 1 tumor necrosis factor receptor shedding aminopeptidase re
Human Orthologue:
ERAP1
Human Description:
endoplasmic reticulum aminopeptidase 1 [Source:HGNC Symbol;Acc:18173]
Mouse Orthologue:
Erap1
Mouse Description:
endoplasmic reticulum aminopeptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1933403]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa38471 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38471
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098527 Nonsense 485 710 9 14
ENSDART00000136806 None None 343 None 6
ENSDART00000145187 Nonsense 504 960 10 19
ENSDART00000147224 None None 252 None 5
Genomic Location (Zv9):
Chromosome 5 (position 27886247)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25641545
GRCz11 5 26241698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTGAATACCTGATGTAGGTTTGTGATTCCGATGGTCTGGATGAGGGC[C/T]GACTGAAGGGTGATGAGTCCTGTCGGCATTCAGCCTCAAACACTGGAGCT
Associated Phenotype:
Not determined