Busch Lab

ZMP

arnt

Ensembl ID:
ENSDARG00000021855
ZFIN ID:
ZDB-GENE-060126-7
Description:
aryl hydrocarbon receptor nuclear translocator isoform a [Source:RefSeq peptide;Acc:NP_001007790]
Human Orthologue:
ARNT
Human Description:
aryl hydrocarbon receptor nuclear translocator [Source:HGNC Symbol;Acc:700]
Mouse Orthologue:
Arnt
Mouse Description:
aryl hydrocarbon receptor nuclear translocator Gene [Source:MGI Symbol;Acc:MGI:88071]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36026 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44836 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16681 Essential Splice Site Available for shipment Available now
sa45561 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36026
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029485 Essential Splice Site 36 503 2 15
ENSDART00000081852 Essential Splice Site 36 728 2 20
ENSDART00000121648 Essential Splice Site 36 746 2 21
ENSDART00000123253 Essential Splice Site 36 404 2 12
ENSDART00000127554 Essential Splice Site 36 440 2 13
Genomic Location (Zv9):
Chromosome 16 (position 5551792)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4778345
GRCz11 16 4607634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGATCTCATTCCAACGGTGTGCAAAAAGCCAACAAACGGCAAGCCACG[T/G]AAGTCTGAAGTGTGAACACTCAGCGTCTCATTAATCCTGCTGAAACACTG
Long Flanking Sequence:
ATTTTTTGTGAGATTATTTCCAGTTTTGGCTTTGGTACTGACTAATCAAATGTATCAGCACAGACAGAGCTTCTACAGTGCAACAGAATTACAGAGACCGGACAAAAAAAACAGATAATAAATATATTTTAAAAAGAAGTAAGCAGTGAATGCAAATATACAAATTAACAAGTGTATGTGTACAGGTATATTGCTATATACAAAGTTATATGTGCTGCTGTATATGCATAAATATAATCCTGTAGAAAGTATGAATTTCAAATAGAGATCTGTGAGAGGTGTACGTTTATTCAGGCTGAGCACCGTATAGTTAACTTGATTATAGTTATCAGTTGACTTAAATTGTGAGATGAGATTTCTGTCATATCACCCGGCCCTGGTTATCATTCTGGTCTGTGTGTTTTGTTTTAGATATGTCTGAGGTCCCGTCTCTGGCCATGACCTCCTCTAATGGATCTCATTCCAACGGTGTGCAAAAAGCCAACAAACGGCAAGCCACG[T/G]AAGTCTGAAGTGTGAACACTCAGCGTCTCATTAATCCTGCTGAAACACTGTTTAGTTGAAAAAGGAGAGTTCTGACGTCTTTTTGACCCTTTTTTAATCTGTTGACCTTAAAAGGAGATGCTTTGGGAAATGTGTCTTCAAAAATGACCAAAAACATCATGAATATTACTGCTGTTGAACGATTATTGCTTCCAAAATAAAAGTTTGTATTTACATTAGTGATGGGTCGTTCTTGAACGATTCGTTCATTTTGAACGAATCTTCAAAATCATTCGGGAACTGCGAGTTCTCACAGGAAGTGATTGGTTTATCTGCGCGTGCGCACATTTGTGCAGGTGGTATTGTTCATTTCAAGTCTTTTGAGTCGTTCATCGCGGAAAGGCAGAAGCCAATCATATGTGTTTAGAGCCGGAAAAATAATTGATCCGTTCATCTCTCGAGTCCTCTATCGGTGAACTCGATGAACATCTCGATGAACGAGACTCAAAGATCAGAGTCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1841
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029485 Nonsense 173 503 6 15
ENSDART00000081852 Nonsense 173 728 6 20
ENSDART00000121648 Nonsense 173 746 6 21
ENSDART00000123253 Nonsense 173 404 6 12
ENSDART00000127554 Nonsense 173 440 6 13
Genomic Location (Zv9):
Chromosome 16 (position 5535987)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4762540
GRCz11 16 4591829
KASP Assay ID:
554-1832.1 (used for ordering genotyping assays)
KASP Sequence:
AGACTGGTCGCGTTGTTTACGTGTCGGATTCTGTAACGCCGGTTTTAAAC[C/T]AGGCTCAGTCAGACTGGCTGGGATCTTCACTATATGATCAGCTTCATCCA
Long Flanking Sequence:
AAACTCTTTACCTGCACAGAGGGAAAAATGGTGCTGTTATCAATATCTATAGTGAAATTATCAGCTTTATCCAAAACACTTTTAGTGCCGATGAGAAGGGCTTCAGTTTTGTCACTATTTAATTTTATAATGTTAGCTGAAAGCCAGATTTTTATTTCAGCTAAACATTTGCACAAAGCAGAAGGAGGAAAAGAACAGGAGGGCTTGGTGGACAGGTAGAGTTGACTGTCGTCAGCATAACAGTGAAATTGTATGTTGTATTTTCTGAAAATGTGACCAAGAGGCAGTAGATATATGATAAACAAGAATGGACCCAGTACAGAACCCTGTACTGAATGATTTTGATGATGGTTCTGTAAATATTTTCACTATCTCTCTCTGTCTCTGTGTAGGAGCTGAAGCATCTGATTCTGGAGGCAGCTGATGGTTTTCTCTTTGTCGTGTCGTGCGAGACTGGTCGCGTTGTTTACGTGTCGGATTCTGTAACGCCGGTTTTAAAC[C/T]AGGCTCAGTCAGACTGGCTGGGATCTTCACTATATGATCAGCTTCATCCAGACGATGTGGAGAAGCTCAGAGAGCAGCTTTCCACCACCGAGAACAATAACAACAGCGGTGAGAAACCACTGCCATACTTTCTGCTGAAAATCCCTAGTTCAAATCATTCATTTTATTAAAACGAACAACTGATTTCTTTTATCTTTGCCTTGATGACATTACATAATATTTCTCAAGATACTAGTATTAATGTTATCAGCTTTACGTGACATTTTAAAAGTTAACTTGGCAATTTAGGGTAATTAGGCAAGTCATTGTATAACAGTGGTTTGTTCTGTAGACTATCAAAAGCAAATATATCTTAAGGGGGCCAATAGTATTGACCTTAAAATGTTTTTTTAATTATAAATTGCTTTTATTCTAGCCAAAATAAAACAAATAAGACTTTCTCCTAAAGAAAAAATATTATCAGACATACTGTGAAACATTTCTTGCTCTGTTAAACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029485 Essential Splice Site 319 503 10 15
ENSDART00000081852 Essential Splice Site 319 728 10 20
ENSDART00000121648 Essential Splice Site 319 746 10 21
ENSDART00000123253 Essential Splice Site 319 404 10 12
ENSDART00000127554 Essential Splice Site 319 440 10 13
Genomic Location (Zv9):
Chromosome 16 (position 5531121)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4757674
GRCz11 16 4586963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATAATCAGGGAAATCGTTTCTGTCTAGTTGCCATCGGAAGGCTACAG[G/A]TACTGCTTTTTTGTTCATGTATTCATATTTAAAACAAATCTGCACTGAGT
Long Flanking Sequence:
GCCTTACAAACGGGAAGGAGCCTTGGGCTCGAGGATCTTATGAGCTCAGGGCTCTCTTCTGGGACAGCATGCCAAACAAGCTTTATAATCAATCATCAGCTAAGTGTGAACTCTTCAAATATATTTAAGTAGCTTTGACTGAAAGAAGAAAGTCAGCTATACCTAAGATGTCCTAAAGCTGAGTAAATCATGGAATAATTGTAATTTGTGCGTGAACTAACCCTTCTCTCATCTCCTGTTGTTCTGCAGGAACGGATTGGGTTCTGCTAAAGACGGCGAGCAGCAGTATGTGGTTGTCCACTGCACAGGCTACATCAGATCTTGGCCTCCTGCAGGTACAGCATACACGCACACAATACACCGGAAGTGGCTATTGTTTACACAGAGTGGAGCTGGGTATAATATCTGGCTTTATCCTCTCAGGAATGAACCTGTCTGAGGAGGAGGCTGATAATAATCAGGGAAATCGTTTCTGTCTAGTTGCCATCGGAAGGCTACAG[G/A]TACTGCTTTTTTGTTCATGTATTCATATTTAAAACAAATCTGCACTGAGTCATGGTTTTGCTTCATTATCTTTCTCTTATGGCTTTGTTGTGAAAAATTAATTGTCAACTTTGTTTAAACTTTTTAATAATATGTTATTTATAACCAGTGTTGGGCATGTATGTGGTTGTCCGACCCCTACACACACAATCAACAATGAGTTGATATTCTCCTCAGTTTAAAACTCACTGTATTCAGTTTTTTAAAGGTCCCATGAAATTAAAATAAAGTTTTTAGATGTTAGTACAAGTATTGTTAGATTTTAAGATATCCACAGGCTAGTGTGCTCCAGAACAGTGTCAAAACTTGCGCTTGGAAGATATAAAACTGATCTAAACATGTAAAGCTTGTAGTTTGTCACTTCCACCTAGGGCATCCCGAGTTTGAATCCCGGCTCGAGGACATTTCCCGACCTTGCCCCTTCTTACTCTCTCCTACTTCATTTTCTGTCTGATTACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029485 None 483 503 15 15
ENSDART00000081852 Essential Splice Site 517 728 None 20
ENSDART00000121648 Essential Splice Site 517 746 None 21
ENSDART00000123253 None None 404 None 12
ENSDART00000127554 None None 440 None 13
Genomic Location (Zv9):
Chromosome 16 (position 5520325)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4746878
GRCz11 16 4576167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTTTCAGGTTTCAGTGCAGACCTGTGGTGTAGTCAGTGCTGAKCACAG[T/C]AAGACTCCTCTCTCACACATATGCATACACTCACTGAAGACAACCCTCAT
Long Flanking Sequence:
ATTTAAGTTAGCCTGCTTGATCACATGTAGCCTTGTATGATCATTGGATGTCATGACAACAGAGTCGCGAAAGAAAACTCTGAATATTTTGTCTTCGGTTTTATTTCGGCCTGTATTCTTTTTGACAAAAATACAAACAACTAAACAGTTGATTTACAAGGTTTACGCATTTATCAATGAAGGAAATCCTTTATTTGAACTCTTTACAAATGGTCTTGCAATACGAAATGGAGTCAGATCCGGATTGAATACCCTCGCAGTCCGGATCTGGACCAGAGGTCGGACTTTGAGAAGCCCTGATGTAGATGAGCAAAAAAATAATAAGAAAGAAATAATAAGTCAAAATTTCGACAAGCAAATTGAGTTTTTAAAAAAGTTTGTTCTGATTATATGTGAATAAGCTCTGTTCAAATAGTTTACCACATCATGAGTGTCTTTGTCCATTTGTGTGTCTTTCAGGTTTCAGTGCAGACCTGTGGTGTAGTCAGTGCTGATCACAG[T/C]AAGACTCCTCTCTCACACATATGCATACACTCACTGAAGACAACCCTCATTAAGAAGAGCTGAGGGATATGTTCAACAAAAAAAAAAAATTTCACAGATCTACTATTAAAACCATTTGTGATGATGATGATGATGTGGTTGTGTGTCTGTGTGTGTCAGGCTCTAAGGCTGTTTCCTCCAGTGTATCCAGTGGGCAGCAGGTTTACCCACCAGCAGCAGCTTTCCCCAGCCCTGCACGACCCACTGAAACTTTCAGGTACACACACACACACACACACACACACACACACACACACACACACACATTCTCTCTCGCTCTCTCTCACACACACAGACTCTCAAACGGACACACTGAGATGCACCGCACAAACTCAGACACACTTTTACACAGGCTCACACGTACAAACACACATTGATGCACACTGCTATGCAAACACTCACAAACACATACACACAGATTTACAGGCACAGACTTTCACACCGACATGCACTGGACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45561
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029485 None None 503 None 15
ENSDART00000081852 None 612 728 19 20
ENSDART00000121648 Essential Splice Site 612 746 19 21
ENSDART00000123253 None None 404 None 12
ENSDART00000127554 None None 440 None 13
Genomic Location (Zv9):
Chromosome 16 (position 5515150)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4741703
GRCz11 16 4570992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATATTCTGTCTGGCCCTGCTCATATGTAAATCCCCTCTCTGTCCAGCA[G/A]GTTGCAGGTCCAATTGGAAAGAACCAGTCTGCTCCGTTTAACATGGGAGG
Long Flanking Sequence:
TCTTTAAAAGCATGTTTTGCCGGGTTGTTATTATTTTGAATACTGTTAGACTCCCCTAAAAATGTCAAATAGACCTATTCAAAAGTTTTAAAAAAGCTGGTGATATCGAAATATATATCGCAGAAATTTTTTTCCAATAGCCCTACTGTGATTAGATCATTGAGTCATTGTAAATTCATATTTATTCAATTTTTTTAATTAATTGCATTAATATATTATTGACTAATATGAAAATGTTCATGATTTATTAACAATACAGTTAGTAAAGTAATATTTTCTGTCTTTTAGTATATATTATATCACACGTGTATATTTTTATGTAAAACATATATATATATATTTTTTTTCATAAATTAAGTTTTTAATTACCATACTCCTAAAATCATTCTGCATAAATGCGCAGATTTTTCTTTTTTACAAAATTCTGCATAGATATAGCTAAAAATGTCCGCATATTCTGTCTGGCCCTGCTCATATGTAAATCCCCTCTCTGTCCAGCA[G/A]GTTGCAGGTCCAATTGGAAAGAACCAGTCTGCTCCGTTTAACATGGGAGGCTTTAGCTCCGCCTCTGCACCCTCCACTTCCTCTTCCTTTGGCCAGATGGGCGGAGCCTCGGCTTCAATGGCAAGCACATCCAGCTACCAGCAAATAAACAGTCACAGCAACCCCTCCACTAATGGATACGGTACATATTGTGCAGCTTTAGATTGTGTTATGTTTTGTGTTGTTTGTGTTACATGTTTTGTCTCATATGTTTTGTGCTATGTTATGCTACGTTATGTTCTAAGCATATATAATAAGCAGTGGTGCTTCTTGTGTTCAGGTGATGTTGGTCAGATGGCAGCAGCGTTTGGCTCCAGGCCAGCAGAGGGCGTCACAGGCTGGCAGCAGTGGCCCAGTCAGACACACACACAAGCCTCCGCAGACACACAAGTGCAAAACAACCAGACAGACATATTTCCGGTGAGTGGAGCAAACGTCAAGTCAAATTGAGCTGGGTTCGG
Associated Phenotype:
Not determined