Busch Lab

ZMP

fzd3

Ensembl ID:
ENSDARG00000021664
ZFIN ID:
ZDB-GENE-990415-225
Description:
frizzled-3 [Source:RefSeq peptide;Acc:NP_001036226]
Human Orthologue:
FZD3
Human Description:
frizzled homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:4041]
Mouse Orthologue:
Fzd3
Mouse Description:
frizzled homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108476]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37109 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8665 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37109
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090549 Essential Splice Site 66 685 2 6
ENSDART00000113294 Essential Splice Site 66 639 3 7
Genomic Location (Zv9):
Chromosome 20 (position 35251909)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35324422
GRCz11 20 35227301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATGAAATTATTAATATTATTAACGTTACACTATTCTCTTTCTATACA[G/T]CCCTTTCATCCTATGGTGAACTTGGAGTGCTCTACTGAAATACGGCCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8665
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090549 Nonsense 114 685 2 6
ENSDART00000113294 Nonsense 114 639 3 7
Genomic Location (Zv9):
Chromosome 20 (position 35251764)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35324277
GRCz11 20 35227156
KASP Assay ID:
2261-4682.1 (used for ordering genotyping assays)
KASP Sequence:
TGACCYTSCCATGTCGCCGYCTGTGCCAGCGGGCTAAGAGCGACTGCTAC[A/T]AGCTCATGGAGATGTTTGGGGTCAGCTGGCCAGATGAGATGGAGTGTAGC
Associated Phenotype:
Not determined