Busch Lab

ZMP

si:dkey-151g10.3

Ensembl ID:
ENSDARG00000021611
ZFIN IDs:
ZDB-GENE-050309-232, ZDB-GENE-090312-81
Human Orthologue:
WNK3
Human Description:
WNK lysine deficient protein kinase 3 [Source:HGNC Symbol;Acc:14543]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa6736 Nonsense Mutation detected in F1 DNA Not yet available
sa15224 Essential Splice Site Available for shipment Available now
sa501 Nonsense Available for shipment Available now
sa37712 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45803 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10232 Nonsense Available for shipment Available now
sa32443 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29932
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 268 1651 4 37
ENSDART00000132799 None None 627 None 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 Nonsense 212 522 3 7
Genomic Location (Zv9):
Chromosome 23 (position 25485188)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25271308
GRCz11 23 25197849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAGCGCTTTAAGGTGATGAAGCCCAAGGTTTTGCGCAGCTGGTGCCGG[C/T]AGATTCTGAAGGGTCTCCAGTTCCTACACACTCGTACGCCACCCATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6736
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 574 1651 10 37
ENSDART00000132799 None None 627 None 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25492078)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25278198
GRCz11 23 25204739
KASP Assay ID:
554-4991.1 (used for ordering genotyping assays)
KASP Sequence:
AARGTGAGCTGCAACAGCAGGTGTTTATACAGCAACCTCAAAGCAAACCC[C/T]AACAAYAAGTTGGGATACARCCTCAAGTTCAGCAGCATCAGACATCAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1259
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 576 1651 10 37
ENSDART00000132799 None None 627 None 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25492084)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25278204
GRCz11 23 25204745
KASP Assay ID:
554-1174.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTGCAACAGCAGGTGTTTATACAGCAACCTCAAAGCAAACCCCAACAA[C/T]AAGTTGGGATACARCCTCAAGTTCAGCAGCATCAGACATCAATACAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15224
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Essential Splice Site 813 1651 16 37
ENSDART00000132799 None None 627 None 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25495958)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25282078
GRCz11 23 25208619
KASP Assay ID:
2261-7790.1 (used for ordering genotyping assays)
KASP Sequence:
CAAGTTTGACAYTGAGGGAGATGCACCTGAAGACATTGCAGATTACATGG[T/C]AATATATNTTTTTTAGCTGCTACAGTRATTCATTTGCTTYTTGTGAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa501
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 860 1651 20 37
ENSDART00000132799 None None 627 None 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25496585)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25282705
GRCz11 23 25209246
KASP Assay ID:
554-0219.1 (used for ordering genotyping assays)
KASP Sequence:
AAACAATGATTAATTTTATATAGTAGCATATGTTGTTCTTTTTATTATTT[C/A]AATTTTTTTGTCACAGACTGGATCCCTGGAGCAGCTCCAAGTGAGCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37712
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Essential Splice Site 1384 1651 32 37
ENSDART00000132799 None None 627 None 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25502655)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25288775
GRCz11 23 25215316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTACAAGAGTGACAACGCTGTAGCTGTAGTGTGTGCATGGCCAAAATTG[T/A]AATTTTGGCTTTTTTAAATGAGCAGATTTTATTTAGCTTTATTGCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45803
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Essential Splice Site 1405 1651 33 37
ENSDART00000132799 None None 627 None 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25503905)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25290025
GRCz11 23 25216566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACAGTTTGCGGCTTTTTTCTCCACTTGTACAAATAGATGGAGGTTTAG[G/A]AGACAGACTATCACCATCTGCGCTGGTTTGGCATCAACTCGTCTGTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10232
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 1537 1651 35 37
ENSDART00000132799 Nonsense 358 627 5 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25507545)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25293665
GRCz11 23 25220206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGARCTACAGGATTTGTACAAGCAGCTCCGCTCTCTCAAAGACCACAGA[C/T]AGCCAATGTCYATGAGCCTKTCCCGCACCTCTCCTCTGCCCTCCGCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32443
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 1633 1651 37 37
ENSDART00000132799 Nonsense 481 627 7 8
ENSDART00000136675 None None 133 None 3
ENSDART00000140789 None None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25508577)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25294697
GRCz11 23 25221238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGTCAAAGGAAACTGTTTGTCCAGTTCAGCCCAAGCCTTCGCTGAAT[C/T]AGATTAAACAGATCCAACAAGTGCAGGAGTTGGGTGGATGGAGCCAGCCT
Associated Phenotype:
Not determined