Busch Lab

ZMP

park2

Ensembl ID:
ENSDARG00000021555
ZFIN ID:
ZDB-GENE-050417-109
Description:
E3 ubiquitin-protein ligase parkin [Source:RefSeq peptide;Acc:NP_001017635]
Human Orthologue:
PARK2
Human Description:
parkinson protein 2, E3 ubiquitin protein ligase (parkin) [Source:HGNC Symbol;Acc:8607]
Mouse Orthologue:
Park2
Mouse Description:
Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45478 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45478
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029649 Essential Splice Site 21 176 1 5
Genomic Location (Zv9):
Chromosome 13 (position 3059807)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3237226
GRCz11 13 3370576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCGCTCATTAAAGAGGTTCATCATTTCCATGTCCTGGGAGAAGAGCAG[G/A]TATGTTTGGACTAATGCAAACACACACATTTCAGCAAATCTCCCTTTGAA
Associated Phenotype:
Not determined