Busch Lab

ZMP

si:ch211-267e7.7

Ensembl ID:
ENSDARG00000021480
ZFIN ID:
ZDB-GENE-070912-266
Description:
LOC567907 protein [Source:UniProtKB/TrEMBL;Acc:A7MBT4]
Human Orthologue:
OLFML2B
Human Description:
olfactomedin-like 2B [Source:HGNC Symbol;Acc:24558]
Mouse Orthologue:
Olfml2b
Mouse Description:
olfactomedin-like 2B Gene [Source:MGI Symbol;Acc:MGI:2443310]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45097 Nonsense Mutation detected in F1 DNA Not yet available
sa19726 Essential Splice Site, Missense Available for shipment Available now
sa11701 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45097
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370 Nonsense 3 466 1 7
ENSDART00000128505 None None 679 None 10
ENSDART00000131501 None None 258 None 2
ENSDART00000135558 None None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20374611)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20947221
GRCz11 2 20605193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTGAGATTGTTCTTGCAGCTCTTCTTGAGGAATCTTCATAATGGGAT[T/A]ACTGTTATATATTTTTTGCTGTGTTTTTTGTTTGACACGCGCCAATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19726
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370 Essential Splice Site 225 466 4 7
ENSDART00000128505 Missense 195 679 4 10
ENSDART00000131501 None None 258 None 2
ENSDART00000135558 None None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20378007)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20950617
GRCz11 2 20608589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCCTTCACTGCAGAAGAACGCAGCAGCGGCTTTTGCTCACACTGAG[G/A]TACAGATGCAGTATATTCTAGCACGATCTTTTAGAAGAGCCTAAATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11701
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370 None None 466 None 7
ENSDART00000128505 Nonsense 524 679 9 10
ENSDART00000131501 None 103 258 2 2
ENSDART00000135558 None None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20383650)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20956260
GRCz11 2 20614232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATAGAGCTTTTTCTCGWGATATAATCAGGTTTGATCTTCGTCTCCGGTA[T/A]GYTGCAGCCTGGACCACCCTTCATGACGCAATATTAGAGGAGGAGGAGGC
Associated Phenotype:
Not determined