Busch Lab

ZMP

si:ch211-232m7.1

Ensembl ID:
ENSDARG00000021455
ZFIN ID:
ZDB-GENE-030729-18
Description:
Sb:cb627 protein [Source:UniProtKB/TrEMBL;Acc:A4QN46]
Human Orthologue:
STRBP
Human Description:
spermatid perinuclear RNA binding protein [Source:HGNC Symbol;Acc:16462]
Mouse Orthologue:
Strbp
Mouse Description:
spermatid perinuclear RNA binding protein Gene [Source:MGI Symbol;Acc:MGI:104626]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa27567 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1941 Nonsense F2 line generated Not yet available
sa34855 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34854 Nonsense Mutation detected in F1 DNA Not yet available
sa41598 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27567
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Essential Splice Site 146 658 5 18
ENSDART00000129151 Essential Splice Site 146 690 5 19
ENSDART00000130734 Essential Splice Site 146 690 3 17
ENSDART00000132375 Essential Splice Site 146 161 5 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9861116)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9936982
GRCz11 10 9895220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGACTTTGCTGAGCACCGTCTGTGAGCACCTCCCACAGCAGATTGAGG[T/A]AATGGCACACACCTGCCGATAGAAAAGACACATGAGCAAGTCAAGCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1941
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Nonsense 153 658 6 18
ENSDART00000129151 Nonsense 153 690 6 19
ENSDART00000130734 Nonsense 153 690 4 17
ENSDART00000132375 Nonsense 153 161 6 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9850323)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9926189
GRCz11 10 9884427
KASP Assay ID:
554-1929.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTRCACTTTTACCCTCTGACCTCTGCAGAAGCTGACGGAGGAGAAGTA[T/A]GAGGTACAGCAGTGTATTCCTGAGGCCGCCATCTTAGTCTGCACCACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34855
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Essential Splice Site 195 658 6 18
ENSDART00000129151 Essential Splice Site 195 690 6 19
ENSDART00000130734 Essential Splice Site 195 690 4 17
ENSDART00000132375 None None 161 None 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9850197)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9926063
GRCz11 10 9884301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCTCACCTCTCCGCAGTTTAAAGACGACTGTGAGACCGAGGAGCAAGG[T/C]TTGCGGTTTCTGTCTTTTCTTTTTTTTTCTTAGCAGGAGGTGAGGGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34854
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Nonsense 259 658 9 18
ENSDART00000129151 Nonsense 259 690 9 19
ENSDART00000130734 Nonsense 259 690 7 17
ENSDART00000132375 None None 161 None 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9836251)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9912117
GRCz11 10 9870355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAATGAATTAGTCTTTGACAGATGACTTGCTCTTTTGTCCACAGCCTT[T/A]GGAGTTAATATGCGAAAAGGCCATTGCCACATGTAACAGACCTCTGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41598
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Nonsense 656 658 18 18
ENSDART00000129151 Nonsense 656 690 18 19
ENSDART00000130734 Nonsense 656 690 16 17
ENSDART00000132375 None None 161 None 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9809942)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9885808
GRCz11 10 9844046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTCTTGCACTTCACCGTTCTCACAGGCTTCGGAGCCCCATACGGGTA[C/A]AGCGCAGCGGCCGCCACTCCTGCATACGGTACGTACCCCTTCCTTCCCCT
Associated Phenotype:
Not determined