Busch Lab

ZMP

cdh11

Ensembl ID:
ENSDARG00000021442
ZFIN ID:
ZDB-GENE-980526-170
Description:
cadherin-11 [Source:RefSeq peptide;Acc:NP_571289]
Human Orthologue:
CDH11
Human Description:
cadherin 11, type 2, OB-cadherin (osteoblast) [Source:HGNC Symbol;Acc:1750]
Mouse Orthologue:
Cdh11
Mouse Description:
cadherin 11 Gene [Source:MGI Symbol;Acc:MGI:99217]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa27024 Missense Mutation detected in F1 DNA Not yet available
sa14413 Nonsense Available for shipment Available now
sa31589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27024
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002279 Missense 206 800 3 11
ENSDART00000127332 Missense 203 797 3 11

The following transcripts of ENSDARG00000021442 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 44758418)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 43445843
GRCz11 7 43785068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGCTACAGACGCAGATGACCCCACATATGGTAACAGCGCCAGACTGG[T/G]CTACAGCATCCTGCAGGGCCAGCCTTATTTTTCTGTGGAGCCGCAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14413
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002279 Nonsense 454 800 7 11
ENSDART00000127332 Nonsense 451 797 7 11

The following transcripts of ENSDARG00000021442 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 44751416)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 43438841
GRCz11 7 43778066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTTTCACCATTAATCCTGAGGACGGCATAATTAAGACCACAAGGCCTT[T/A]AGATCGGGAAGCACAGGCTTGGCACAAYATTTCTGTCAGCGCTACAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31589
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002279 Nonsense 785 800 11 11
ENSDART00000127332 Nonsense 782 797 11 11

The following transcripts of ENSDARG00000021442 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 44734871)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 43422296
GRCz11 7 43761521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAGACCTGGACTATGATTACCTCCAAAGTTGGGGGCCACGCTTCAAG[A/T]AACTAGCCGATCTTTACGGCACCAAAGACTCCGTCGATGACAACTCTTAA
Associated Phenotype:
Not determined