Busch Lab

ZMP

jag2

Ensembl ID:
ENSDARG00000021389
ZFIN ID:
ZDB-GENE-011128-3
Description:
protein jagged-2 isoform 1 [Source:RefSeq peptide;Acc:NP_571937]
Human Orthologue:
JAG2
Human Description:
jagged 2 [Source:HGNC Symbol;Acc:6189]
Mouse Orthologue:
Jag2
Mouse Description:
jagged 2 Gene [Source:MGI Symbol;Acc:MGI:1098270]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
hu3425 Nonsense Confirmed mutation in F2 line Not yet available
sa13408 Essential Splice Site Available for shipment Available now
sa23675 Essential Splice Site Available for shipment Available now
sa45693 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1720 Essential Splice Site Available for shipment Available now
sa10654 Nonsense Available for shipment Available now
sa29338 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10420 Essential Splice Site Available for shipment Available now
sa6629 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4891
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 23 1254 1 26
ENSDART00000049586 Essential Splice Site 23 1216 1 25
Genomic Location (Zv9):
Chromosome 20 (position 21463572)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21491739
GRCz11 20 21391412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAGGAATTGGCTCCCAATMGCGTGCCTGCTGTTAACGATGTGGACGAAG[G/A]TGAGAGCTCTGATTGTTATTAGTGTTGCAGATCGATTTAATTGCCGTAGC
Long Flanking Sequence:
TCATCACTGTGTGTTTAGAAATCATTAACGTGATAAAAATACTAATTCTGCAAATTACGCATTACAAATATCCAAATTCCTGACAGAAAAGAAAGCACGCTGTTTAATTGCTCGTTGTGAAACAGAGGGAATAGAGCTCGTAAGTTTTTTGGCCAGGCTCCGCCCCCGAGTGGCGATTGGCCAACCGCATCAGCAGGGGGGATACTGATTGGCCCTTCCAGCTGTCAATCACGCGAGATCTCCTCAGGCGTGTGGTAGCCGTGAAACATATCATTTGCCGTGAAGTGATCAGACCGAGGGAGAGATCAGCACAGACCATCACCGCGCAAACACACCACGCTCGTGAATTTTTGCATGTCAGGAACGGAGGATCCTGTCGCCGGTCATCGGCCGTTTTCCATCTTGCGTTTATAACACATCAAATCGGCGGCATGTGGAATTGTATCAGGATTAGGAATTGGCTCCCAATCGCGTGCCTGCTGTTAACGATGTGGACGAAG[G/A]TGAGAGCTCTGATTGTTATTAGTGTTGCAGATCGATTTAATTGCCGTAGCACTGATCAGGAGGCAAAAGTTGATGGGTGTGGGCAGACGATTTCAACCGTTTCTGCTTAAAGTGATCGATATTTGAATTACGCAGCCACATGTGCGCGTGCATTTGGAAATGTCAGATGTAAGAAATGTTAACTTGAAACACGATTCCTCATTAAAAGCACGGGTGGATCAGTTTTATAGGATATTGTATGAAATAAAGCCGATTTTCTCATCTCATCCGCATAACAGGTTTGCAAAATTGTAGACTGATTCTCTGGAGACTTGAATGCACAAGCGCACGCGACACATTCCCTCAAATTAACATTAGCACAGATTTATCTGCATTTCTGTAATGCACAATCAGCATTATGATTGCTCTGTTTGTTTGTTTATTTATTTGTCTTTCTGTTTTTCAATGTATTTTTAGGTGTCCCAGTCCTCTGGCTATTTTGAGCTGCAGCTGATTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3425
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Nonsense 30 1254 2 26
ENSDART00000049586 Nonsense 30 1216 2 25
Genomic Location (Zv9):
Chromosome 20 (position 21464049)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21492216
GRCz11 20 21391889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTCTTTCTGTTTTTCAATGTATTTTTAGGTGTCCCAGTCCTCTGGCTA[T/A]TTTGAGCTGCAGCTGATTGCTGTAGAAAATGTAAACGGTGAGTTGTGGGA
Long Flanking Sequence:
TGCTGTTAACGATGTGGACGAAGGTGAGAGCTCTGATTGTTATTAGTGTTGCAGATCGATTTAATTGCCGTAGCACTGATCAGGAGGCAAAAGTTGATGGGTGTGGGCAGACGATTTCAACCGTTTCTGCTTAAAGTGATCGATATTTGAATTACGCAGCCACATGTGCGCGTGCATTTGGAAATGTCAGATGTAAGAAATGTTAACTTGAAACACGATTCCTCATTAAAAGCACGGGTGGATCAGTTTTATAGGATATTGTATGAAATAAAGCCGATTTTCTCATCTCATCCGCATAACAGGTTTGCAAAATTGTAGACTGATTCTCTGGAGACTTGAATGCACAAGCGCACGCGACACATTCCCTCAAATTAACATTAGCACAGATTTATCTGCATTTCTGTAATGCACAATCAGCATTATGATTGCTCTGTTTGTTTGTTTATTTATTTGTCTTTCTGTTTTTCAATGTATTTTTAGGTGTCCCAGTCCTCTGGCTA[T/A]TTTGAGCTGCAGCTGATTGCTGTAGAAAATGTAAACGGTGAGTTGTGGGACGGGGAATGTTGCGACAGCACGCGGAACTCTCAAGACCAGCGCTGCGTGCGGGACGAGTGCGATACTTACTTTAAAGTGTGTCTGAAGGAGTACCAGTCTGAAGTCACCACCACTGGACAGTGCACCTTCGGCTCTGGATCTACCGACGTTCTTGGTGGAAATATAATTTCTTTTAAGACCGCAAAAAACAGCCCCAGCAAAACGAGCGACGTGGGAAAGATCATCATCCCTTTTCACTTCGCCTGGCCGGTGAGTCCTCGTCTTCTCCATGGGCTGTAATAAAAAAACGCGCCGCGGTGAGCTGTCACTGCTCGGAAGTTGAGTGCACTATATTGTTAGGGTGATGACAGGGTCTCTATTTTAATCGTGGGGCGTGTAGGCTGCTGTCTTTTAACGATTTTCTGTTATTTCTGTGACTGCTTCATCTGTAGGGCACTCACTTTGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13408
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 130 1254 2 26
ENSDART00000049586 Essential Splice Site 130 1216 2 25
Genomic Location (Zv9):
Chromosome 20 (position 21464351)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21492518
GRCz11 20 21392191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACGAGCGACGTGGGAAAGATCATCATCCCKTTTCACTTCGCCTGGCCGG[T/G]GAGTCCTCGTCTTCTCYATGGGCTGTAATNAAAAAACGCGCCGCGGTGAG
Long Flanking Sequence:
GTTTGCAAAATTGTAGACTGATTCTCTGGAGACTTGAATGCACAAGCGCACGCGACACATTCCCTCAAATTAACATTAGCACAGATTTATCTGCATTTCTGTAATGCACAATCAGCATTATGATTGCTCTGTTTGTTTGTTTATTTATTTGTCTTTCTGTTTTTCAATGTATTTTTAGGTGTCCCAGTCCTCTGGCTATTTTGAGCTGCAGCTGATTGCTGTAGAAAATGTAAACGGTGAGTTGTGGGACGGGGAATGTTGCGACAGCACGCGGAACTCTCAAGACCAGCGCTGCGTGCGGGACGAGTGCGATACTTACTTTAAAGTGTGTCTGAAGGAGTACCAGTCTGAAGTCACCACCACTGGACAGTGCACCTTCGGCTCTGGATCTACCGACGTTCTTGGTGGAAATATAATTTCTTTTAAGACCGCAAAAAACAGCCCCAGCAAAACGAGCGACGTGGGAAAGATCATCATCCCTTTTCACTTCGCCTGGCCGG[T/G]GAGTCCTCGTCTTCTCCATGGGCTGTAATAAAAAAACGCGCCGCGGTGAGCTGTCACTGCTCGGAAGTTGAGTGCACTATATTGTTAGGGTGATGACAGGGTCTCTATTTTAATCGTGGGGCGTGTAGGCTGCTGTCTTTTAACGATTTTCTGTTATTTCTGTGACTGCTTCATCTGTAGGGCACTCACTTTGCTCTGCGTGTTTGAAACGGGCTGCTTGAAGGTGCATTTAAGGTGACACGCACCTCTTAAAGAGATAGCTCACTGTTGAATGGAAATTCTGCTACTTGGTCACCTTGTTTCCCACCTGTGTTGGTTATTTATTTTAGAAACACGAAGTAATTAGATAATATTGTTATTTACTCGAAGAAATATTGATTGAAAGTGAATGGTGACTTAAGTCTGTCATCCTGTCAAGCGGAAGCTTTAAAAGATACTTTCTAACAGAATAGTTTGTTTTAATTGGCTGTGTTACAAATCTGCTTAGTTGTACATCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23675
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 255 1254 5 26
ENSDART00000049586 Essential Splice Site 255 1216 5 25
Genomic Location (Zv9):
Chromosome 20 (position 21502521)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21530688
GRCz11 20 21430361
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCTGTAATCTGATTCACGGAGGCTGTGCGGTGCCTGGAGAATGCAAG[T/C]AAGTGTCTGAGCATCATTTCATGGTCGGTTGGCCCGGCTAATCTAGCTCC
Long Flanking Sequence:
GACCTGCTGCTATCAGTGTTTTCACAGCCCTGCGATCTTTGCTTCTCTGCCTGGAGGTGAGATTGTGTTGTAAACGACACCTCTGGAGTCACACTTTCCATTAGCTCAATTAATCTGGGTGATGCTAGGGTTTTTGATTTCTTCAACCCACCACTGCAGGCAACCTAAACACCTTTCTTTTCCAACACTATAAGTCTGTATGTGTGCATATACACCACTAAAGAAAGGCAGTAAATCACCAGACACCATCTTAATGAGGGAGGGTACGAGTAGGTGGGCGTAGCAGGGGTGGACGGGGGCAAGCGCATGTGTGTGTTTGAGCAATAAAGTTGTCTTCTGTCACGGCGAGCATGATGAATTTATCTTGTCGCACTTGTAAGGCAACACAAACAAACAAGACTGACCTCTCCTCCCTCCTCCCCTCTCTTTCTCTCTCAGCGATCTGCAAGCAGGGCTGTAATCTGATTCACGGAGGCTGTGCGGTGCCTGGAGAATGCAAG[T/C]AAGTGTCTGAGCATCATTTCATGGTCGGTTGGCCCGGCTAATCTAGCTCCTTAATTTCAGCAGGGCCATATGTGCTCATGCTGATAAGGTCTTTTCATTTGTTTACCTTGCTATTAATTAATTAGCGCAGTGAGGACATTGTTTGCGCAAGCAGTTTTTGTTTATTGTGCTTTTTAAAAAATCATGCTGTAGCGTTAAAAAGTTATGATTTGATTGTCATTTGATTAGATTAAATACTTGAAGGCGTCACTAGCACTGTTGTTCATGCTCAAAATGGATAGCTAACCAAAAACTAAACAAAAAAAAATATGATAAACACTTTATAGCCTCCATATTGCCTCAAATGCATTTTCAATTATATTTAAAGGGTCACGAAACACCAAAACACATTTTTTTGTCGAGAAACATGTCGAAAAGTCAGCGCGCCCAAATAGACACTCCCACACCATGCCTCTTTTCTTTCTCCGACACTCCCCCCTAAACAAAGCTGGACACGCCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4892
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 298 1254 6 26
ENSDART00000049586 Essential Splice Site 298 1216 6 25
Genomic Location (Zv9):
Chromosome 20 (position 21510007)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21538174
GRCz11 20 21437847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGCAATGCACTTGTGAGAAGAACTGGGGCGGCCTCCTCTGCGATAAAG[G/A]TAAGGGTCCTGAATGCAGCTGACACACTGATGCTGAAAATGTGACCTAGT
Long Flanking Sequence:
CATACCTCTTCTGCAGGAGAGCCGTCTTAAAATAGCCTGCTCAGAAATGACAAGACAGCTGGGTGAGGGGTGTGGTGGGGGATGGCGAGAGCGCACCACTGGCCTTGGAATAGCGGAGTGTTGCTGTAAACCAATGATTAGTTAACCCCTCTGCAGCATTTCCCTCTGCGACTCAACCGTCCGAAGGGGGGAGTATGCATCTGTGCACGATCGCGAAAGTGTTCTTAACCTTTGTCGCCCGGAATGTCGCCTTGTCCTAAGATTAGGTGTCAGCGCAGAGATGTGCAGCTGTATGTTTATTCCTGTCTGTCATTAAGATGTCACAGTTGTACAGCTCTTTAAGCATTAACAAGGTCATGTGGTTTTCAGGTGCAACTACGGCTGGCAGGGGCAGTTCTGCGACGAGTGTCTACCTTATCCTGGCTGTTTGCACGGTACCTGTGTTATGCCCTGGCAATGCACTTGTGAGAAGAACTGGGGCGGCCTCCTCTGCGATAAAG[G/A]TAAGGGTCCTGAATGCAGCTGACACACTGATGCTGAAAATGTGACCTAGTTAGTTTTGAAAAATTGAGGTCAACCTGGAATTGACCCATAAAAATGGTCAGCAGTAGATCAGAATGATTTGGTTAAGCCTGTGAACATGCAGCCGTGGAGGTGCCAAGGCAGCGAATTCATATCATGGTGTTAAATAGAATTACAGCATCTTACACTGAGCTGGTTTGTTGGCTGCGATGTCAGCACAGGCTGCGCATCATGTGACAACGCGCACACACAAACACGTACTCTGGATATTGTGGTTGTGATTGGAGTGGCGCTCGGATATCTGATCCGTCGGTCAGCGTATGTCCTGGAAGGTGCTTAGGAATGAGAAGCAGCTGAGAGGTGCCTACAGTTCTGTTTATTTATTTACTAGCCTTTATGTGCTCGGCCTTGCCTTACAAGGCCTGCTGGGAGCCAAGCAATAGTTTTGCCAACTGTTTTCAGTAAATGTAGGACTAAACAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4893
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Nonsense 437 1254 10 26
ENSDART00000049586 None None 1216 None 25
Genomic Location (Zv9):
Chromosome 20 (position 21520019)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21548186
GRCz11 20 21447859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGAAGCCTTGCGTAAATGCTCACTCTTGCAAAAACATGATTGGTGGATA[T/A]CACTGTGACTGCTTTCAAGGATGGGCCGGACAGAACTGTGACATCAGTCA
Long Flanking Sequence:
TAAGCAGAACTCAAGCATCACTGTTTTTTGGAACCTTTACTTTTGAGATTGTAAAGATTGTTTTTGTGTGTAATCAAATTTATTGAATAACGAAAGATATTATTAATCTATTAAATTGTGTTTTTCCAGTAAAAATAGCTTTGTTTTTACTAGAACACAAACCAGATACACTAGTAAAGTGTTTTATGTGTGTGTGTGCCTGTGTTATGCTCATTGCTCAGGAAGTCAAGCAGCCCTGGCATCGTTGTGACTGTTAGAGTTTCAAGCCAACAAGCTTTTCAATGGGCTTAATGGTGGTGGGGTTACACAACAAGAGCTCCAATTTCGCCTGCTCCTCTCCTGCTACTCTACACTTCCCATCTCCACTTCGGTCTCGCAATCTACCAAATTGTCTACGAAATCTCCCAACTCTTTCTTTCCCTCACTTTCGCAGATGCAAATGAGTGTATGGGGAAGCCTTGCGTAAATGCTCACTCTTGCAAAAACATGATTGGTGGATA[T/A]CACTGTGACTGCTTTCAAGGATGGGCCGGACAGAACTGTGACATCAGTCAGTATCTCCTCAAGCTCCTCTCCTCTCTTTTCCTCCATCTTTGAGCTCTATAATGGCAGCCAGGCTTTCCTCTTCAGACACTTGATGGCTTTTGGGATTCTTCACGCTGTATATTTGGTCTTAGGCTTCACCTACTGTTGCATGCTGGGCTTTTTTTGTGTGCGTATGTTGATTTAAACTAACATTTCCATCTTCACAGCACTCACCAAAGCTCATCTGATTTGAGTTAATTGCACATCTTCAACTGCTCTCCTTTATTTCCTCCACTTAGCCATTGATTAATTTGCTTTGCTCATTGACTGCAGATCTCAATGGCTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGGTATGTAGACTTTTAAGGTGCTGTATTGTCGCTTCAGCTAATTGTGCTGTTGGTGAAGGGTGGATTTATTTGTGTCTGTGCAGGAGCTGGTTCATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45693
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 453 1254 10 26
ENSDART00000049586 None None 1216 None 25
Genomic Location (Zv9):
Chromosome 20 (position 21520067)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21548234
GRCz11 20 21447907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCACTGTGACTGCTTTCAAGGATGGGCCGGACAGAACTGTGACATCAG[T/G]CAGTATCTCCTCAAGCTCCTCTCCTCTCTTTTCCTCCATCTTTGAGCTCT
Long Flanking Sequence:
TTGTAAAGATTGTTTTTGTGTGTAATCAAATTTATTGAATAACGAAAGATATTATTAATCTATTAAATTGTGTTTTTCCAGTAAAAATAGCTTTGTTTTTACTAGAACACAAACCAGATACACTAGTAAAGTGTTTTATGTGTGTGTGTGCCTGTGTTATGCTCATTGCTCAGGAAGTCAAGCAGCCCTGGCATCGTTGTGACTGTTAGAGTTTCAAGCCAACAAGCTTTTCAATGGGCTTAATGGTGGTGGGGTTACACAACAAGAGCTCCAATTTCGCCTGCTCCTCTCCTGCTACTCTACACTTCCCATCTCCACTTCGGTCTCGCAATCTACCAAATTGTCTACGAAATCTCCCAACTCTTTCTTTCCCTCACTTTCGCAGATGCAAATGAGTGTATGGGGAAGCCTTGCGTAAATGCTCACTCTTGCAAAAACATGATTGGTGGATATCACTGTGACTGCTTTCAAGGATGGGCCGGACAGAACTGTGACATCAG[T/G]CAGTATCTCCTCAAGCTCCTCTCCTCTCTTTTCCTCCATCTTTGAGCTCTATAATGGCAGCCAGGCTTTCCTCTTCAGACACTTGATGGCTTTTGGGATTCTTCACGCTGTATATTTGGTCTTAGGCTTCACCTACTGTTGCATGCTGGGCTTTTTTTGTGTGCGTATGTTGATTTAAACTAACATTTCCATCTTCACAGCACTCACCAAAGCTCATCTGATTTGAGTTAATTGCACATCTTCAACTGCTCTCCTTTATTTCCTCCACTTAGCCATTGATTAATTTGCTTTGCTCATTGACTGCAGATCTCAATGGCTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGGTATGTAGACTTTTAAGGTGCTGTATTGTCGCTTCAGCTAATTGTGCTGTTGGTGAAGGGTGGATTTATTTGTGTCTGTGCAGGAGCTGGTTCATGGAGGTTACCACTGTCAGTGTCCTGCGGGGTTTGTGGGCTTACACTGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1720
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 468 1254 11 26
ENSDART00000049586 Essential Splice Site 430 1216 10 25
Genomic Location (Zv9):
Chromosome 20 (position 21520422)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21548589
GRCz11 20 21448262
KASP Assay ID:
554-1666.1 (used for ordering genotyping assays)
KASP Sequence:
AGATCTCAATGGCTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGG[T/A]ATGTAGACTTTTAAGGTGCTGTATTGTCGCTTCAGCTAATTGTGCTGTTG
Long Flanking Sequence:
CCCAACTCTTTCTTTCCCTCACTTTCGCAGATGCAAATGAGTGTATGGGGAAGCCTTGCGTAAATGCTCACTCTTGCAAAAACATGATTGGTGGATATCACTGTGACTGCTTTCAAGGATGGGCCGGACAGAACTGTGACATCAGTCAGTATCTCCTCAAGCTCCTCTCCTCTCTTTTCCTCCATCTTTGAGCTCTATAATGGCAGCCAGGCTTTCCTCTTCAGACACTTGATGGCTTTTGGGATTCTTCACGCTGTATATTTGGTCTTAGGCTTCACCTACTGTTGCATGCTGGGCTTTTTTTGTGTGCGTATGTTGATTTAAACTAACATTTCCATCTTCACAGCACTCACCAAAGCTCATCTGATTTGAGTTAATTGCACATCTTCAACTGCTCTCCTTTATTTCCTCCACTTAGCCATTGATTAATTTGCTTTGCTCATTGACTGCAGATCTCAATGGCTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGG[T/A]ATGTAGACTTTTAAGGTGCTGTATTGTCGCTTCAGCTAATTGTGCTGTTGGTGAAGGGTGGATTTATTTGTGTCTGTGCAGGAGCTGGTTCATGGAGGTTACCACTGTCAGTGTCCTGCGGGGTTTGTGGGCTTACACTGTGAAGTCTCAAGGAATAAATGTGCCAGCGGTCCATGTCAGAATGGTGGCCGCTGCCATGTCATTCTGGACAGCTTCGTTTGTGAGTGTCCGTCAAACTACGCAGGGATGCTCTGTGAGGTGAGAAGCATTAGTGATTATGGTATTATTATTATTTTAGTTTGGTTTGTATTTTTGGTTGGGTTTAATTAATTAATTAATTTATTTATTTACTTATTTATTTATTTATCTATGTATGTATTTTTGTATATCTATTTATCTTTATTTGTCTATTTATTTATTCATTTATCTATTAATTAATTAATTAATTAATTAATTAATATTTTATGTATTTATTTATTTATGTTTATTTGTCCATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10654
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Nonsense 479 1254 12 26
ENSDART00000049586 Nonsense 441 1216 11 25
Genomic Location (Zv9):
Chromosome 20 (position 21520536)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21548703
GRCz11 20 21448376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATTTGTGTCWGTGCAGGAGCTGGKTCATGGAGGTTACCACTGTCAGTG[T/A]CCTGCGGGGTTTGTGGGCTTACACTGTGAAGTCTCAAGGAATAAATGTGC
Long Flanking Sequence:
AAGGATGGGCCGGACAGAACTGTGACATCAGTCAGTATCTCCTCAAGCTCCTCTCCTCTCTTTTCCTCCATCTTTGAGCTCTATAATGGCAGCCAGGCTTTCCTCTTCAGACACTTGATGGCTTTTGGGATTCTTCACGCTGTATATTTGGTCTTAGGCTTCACCTACTGTTGCATGCTGGGCTTTTTTTGTGTGCGTATGTTGATTTAAACTAACATTTCCATCTTCACAGCACTCACCAAAGCTCATCTGATTTGAGTTAATTGCACATCTTCAACTGCTCTCCTTTATTTCCTCCACTTAGCCATTGATTAATTTGCTTTGCTCATTGACTGCAGATCTCAATGGCTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGGTATGTAGACTTTTAAGGTGCTGTATTGTCGCTTCAGCTAATTGTGCTGTTGGTGAAGGGTGGATTTATTTGTGTCTGTGCAGGAGCTGGTTCATGGAGGTTACCACTGTCAGTG[T/A]CCTGCGGGGTTTGTGGGCTTACACTGTGAAGTCTCAAGGAATAAATGTGCCAGCGGTCCATGTCAGAATGGTGGCCGCTGCCATGTCATTCTGGACAGCTTCGTTTGTGAGTGTCCGTCAAACTACGCAGGGATGCTCTGTGAGGTGAGAAGCATTAGTGATTATGGTATTATTATTATTTTAGTTTGGTTTGTATTTTTGGTTGGGTTTAATTAATTAATTAATTTATTTATTTACTTATTTATTTATTTATCTATGTATGTATTTTTGTATATCTATTTATCTTTATTTGTCTATTTATTTATTCATTTATCTATTAATTAATTAATTAATTAATTAATTAATATTTTATGTATTTATTTATTTATGTTTATTTGTCCATTTATTTATTTATTTATTTATTTTATTTTTCTGTTAATTAATTAATTAAATTATGTTTTTATATATTTATATTTTTATTTATTTATATATTTATTTACTTTTATTTAATTATTTATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29338
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 713 1254 16 26
ENSDART00000049586 Essential Splice Site 675 1216 15 25
Genomic Location (Zv9):
Chromosome 20 (position 21527589)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21555756
GRCz11 20 21455429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTACTGTGAATGTGCCAATGGCTGGAAGGGAAAGACCTGCCATTCACG[T/A]CAGTCTTCGTTTTAAATTTTATTTTTATTTTTTTTCCTGTCTTCTTCCTA
Long Flanking Sequence:
TTAAGTCAGCAAGAACCAAATAATGTAAAAACAATGTACATTTCAAAAATGTAAATCTAATCTAAAAAAAAAACACAAAACTTAACTCTAATTTTGGCTATCAAATGTGTTGTTTCAAATGTGAACTTGTTGTCTTTATTTTAAAATCTTAATGTTTGTGTAAATTTTACTTGTCGTCTACCAGATGTAAATGACTGTGTGAGCAATCCGTGTCGAAATGGAGGCACCTGTATTGACGGGATCAGCTCTTTCCAGTGCTTCTGTCCAGATGGCTGGGAAGGAGACCTTTGCAGCATCAGTGAGTGTCCCTCATCATCATCATCAACTTTATCATCTTAACCTTTTTTTACGCTCACTTCCTTACCCTTCCTACTTGTGCTTTTAGATGTGAACGAGTGCAGTCGGAGCCCCTGCAAAAATGGCGGGCACTGTGTGGATCTGGTCAATGACTTTTACTGTGAATGTGCCAATGGCTGGAAGGGAAAGACCTGCCATTCACG[T/A]CAGTCTTCGTTTTAAATTTTATTTTTATTTTTTTTCCTGTCTTCTTCCTATTGTACTGAATATGTGAGCTGACTGATGATATTTTTTGTGTGTTTTAGGTGAAAGTCAGTGTGACTCCTCCACATGCAGTAATGGAGGAACCTGCTATGATCACGGAGATGCTTTCCGCTGTGCTTGTCCTCCAGGATGGGAAGGAAGTACATGCAATACAGGTAAGAAGAGCTCTAGATACCTGGGTCTATTATATATTACAATATTTTTGGGTATTTATTGCAAAAACAATACTATTGAAAATACAATGCATAAGTATCTAGACGCGTAATATATATAAAAATACAAACAAATAAATAACAGTTGATTTAAATTATTATTATATGTCTTTTTTTCTTAATTTTGAACGTATTTTTAAAGAATAGTGGGACAGTCTATCCAACGTGCTCAACCATAATTAAACACACTGAAGCAGCGAATCAAGCTTTTTAGGATTATATAAAATACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10420
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 828 1254 20 26
ENSDART00000049586 Essential Splice Site 790 1216 19 25
Genomic Location (Zv9):
Chromosome 20 (position 21534728)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21562895
GRCz11 20 21462568
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCGCTGTGAATGTGCTCCTGGATTTGCAGGACCCGACTGCCGTAWCAG[T/C]GAGTATCTCAAAGAGGAAAGAATGGSGACATATAGAAAGAGGGGTGTTGG
Long Flanking Sequence:
AAGCCTTTTGCTGACAGCGATGAATGTTTGTGCCTGACAACAGGTTTTAATTTTTGGTTTCATTCTATAACACTGGAATTATTTTTCCAGGATAGTTTGAACTTTGAGTGTTAAAACGGGAGAAAAGTGTGAATATGTTTATCCCTGTCTGAGAAAAGTGAGAAAAGTGTAGTGGCGGTTTAACAGCCTTAAAACATCTATAATAATTGTAAAAAATAAAGCTAATTATTTCGCCTGTTGCATGTTTTTTTATAATGTAACTCCTGCGATTAATGAGGGACCCCTGTATTATAGTAGATAATAGTGAACATATTATGATAAAACCTTCACATCTATCATTTAGAAATCAAAATATGTCAATCAGTAGGGGAAAGTTGTCTCTTTCGACTAGTGAACTCATTGTCTTCTTGCAGTTACAATGGAGGAATCTGTGTGGATGGGGTGAACTGGTTCCGCTGTGAATGTGCTCCTGGATTTGCAGGACCCGACTGCCGTATCAG[T/C]GAGTATCTCAAAGAGGAAAGAATGGCGACATATAGAAAGAGGGGTGTTGGTGGATTACCGAGCATCCCGTGCCCTTTGACCTCCTCGGGGGTCAAAGGTTGGCCCTTGCTCACAAACAGACAGAGGGGATAAATTATTCAACCAGTGGAAAAATTCCTCTTCTTATGTCTCTTGTGTCCATTGATGCACATAGAAAACACTCCTTAAAGATTCCATGCATTTCCCCAGCCTCATTTTCTGAGGGCTGGTCATGGGAACGCCATCAATCCTGGCGTTTACAAATGCGTATTGATTTGAGATGACAGTTTTAACTTTCTCTGAATATGACATTTCTGCCTGGGCTGTAGCTGTATTGATGAATGTGTGTTCTCTTTGGTTTACCAGACATCGATGAGTGCCAGTCATCCCCCTGCGCCTATGGTGCCACCTGTGTGGATGAGATCAATGGTTTCCGGTGTGTTTGCCCACTCGGTCGCACTGGACCTCAATGCCAAGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6629
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 1083 1254 25 26
ENSDART00000049586 Essential Splice Site 1045 1216 24 25
Genomic Location (Zv9):
Chromosome 20 (position 21542060)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21570227
GRCz11 20 21469900
KASP Assay ID:
554-5389.1 (used for ordering genotyping assays)
KASP Sequence:
GCCGTCATCGAGGTCAAAGTGGAGATGCCGGTCACGTCTCAGCCAGTGGG[T/C]GAGTAGAGCCAACTGGCCTCAAGGCTAAACCAGCMCTCATCCCCCGACCC
Long Flanking Sequence:
GTTTCCTCCGTTCAGTGAAACATTCTGCCTCACGGAAGTTACTTACAAATAGCGGTTATCTCCAAATGCATGCTTTATACTCGGTCAGATTACACTAAATCCCTGCGGTGTTATAACAAGTCACTGAGCGAAGGCCCGTGTTTAACTGGCCTGACTCATTAAAATGGAACCTGTAGGCAGGAACTTTGAACACTGCAGGTTTTTGCATGTTGAAATAATTGAGTCAACCGACTTTTTGATTTGAGTCAACCGCTTTAGTTAAAAGGTTTTTCAACATTTATCTACATGTTTTTGCAGTGCAGTCTGATGTTTATAAACCCTCCATATTATTTTTTTGTTCTCCTGTAGTCGTTCCAGCAGGATGAGCAGCCCAGTCACAGTCAAATCCAGGAGGCTGCGAGTACCATCGTCAGCACACTGTCCAAGCGGCACAACAGCACCGTCATGCTTGCCGTCATCGAGGTCAAAGTGGAGATGCCGGTCACGTCTCAGCCAGTGGG[T/C]GAGTAGAGCCAACTGGCCTCAAGGCTAAACCAGCCCTCATCCCCCGACCCAGTGTCAATTCCCTGTTTCCAGCAATTAGTGCAGCTTAATTGTCTTTGTGAGTCACAGAAGGAAGGGACTGAGTGGCTCAGAGGATGCAGCAGTTGTGGGCAGGAGGCCATAAACCTGTGTGACAGTCATTCAGCTCCTCCACAGTCCTCTGCCACAGCACAGCAATGCATTTAAGATGGCTCACACTTTATTTTTTTTGGATTAAGGGAATTCTAAATAGGTTTTAAAGTATTTGTAACTGAGCACCGACTACATTGGATATAACTGTTGTCCTCAAGTTATTCACAAAGGTTACTGTTAACTTTCATATGTAAAATCAATGGAATCTGACAAGTGTCTCACAAATGTTGTTGTTCAAGGCTTGTGCACACCGGGTGTCGCTTTTTTTCAATGTTTGTTGGTTGTCAGCATTTTACGAGATGTTGTTCTACATTCAAACCCAGGCAATT
Associated Phenotype:
Not determined