Busch Lab

ZMP

zgc:56429

Ensembl ID:
ENSDARG00000021383
ZFIN ID:
ZDB-GENE-040426-1025
Description:
hypothetical protein LOC393247 [Source:RefSeq peptide;Acc:NP_956571]
Human Orthologues:
FOLH1, NAALAD2
Human Descriptions:
N-acetylated alpha-linked acidic dipeptidase 2 [Source:HGNC Symbol;Acc:14526]
folate hydrolase (prostate-specific membrane antigen) 1 [Source:HGNC Symbol;Acc:3788]
Mouse Orthologues:
Folh1, Naalad2
Mouse Descriptions:
N-acetylated alpha-linked acidic dipeptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1919810]
folate hydrolase Gene [Source:MGI Symbol;Acc:MGI:1858193]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6399 Nonsense Mutation detected in F1 DNA Not yet available
sa42624 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6399
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010881 Nonsense 251 745 6 19
Genomic Location (Zv9):
Chromosome 15 (position 42721056)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43900378
GRCz11 15 43923821
KASP Assay ID:
554-5423.1 (used for ordering genotyping assays)
KASP Sequence:
GGAATCTGCCCGGTGGAGGCGCTCARAGGGGGAACGTGCTGAATCTGAAT[G/T]GAGCCGGAGACCCTCTYACACCAGGATACCCTGCTAAAGNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42624
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010881 Essential Splice Site 327 745 9 19
Genomic Location (Zv9):
Chromosome 15 (position 42726078)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43905400
GRCz11 15 43928843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCACTGTGTTTGTGTATTATTAATATTAATTTTTTCCCTTCATTTTA[G/A]AAAAGTGCGTATGAACATCCACACTAACAATCAGGTGACCCGTATCTACA
Associated Phenotype:
Not determined