Busch Lab

ZMP

phf21a

Ensembl ID:
ENSDARG00000021378
ZFIN ID:
ZDB-GENE-030131-6456
Description:
Phf21a protein [Source:UniProtKB/TrEMBL;Acc:Q08CP0]
Human Orthologue:
PHF21A
Human Description:
PHD finger protein 21A [Source:HGNC Symbol;Acc:24156]
Mouse Orthologue:
Phf21a
Mouse Description:
PHD finger protein 21A Gene [Source:MGI Symbol;Acc:MGI:2384756]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18275 Nonsense Available for shipment Available now
sa3290 Missense, Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30203
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021577 Essential Splice Site 107 796 6 17
ENSDART00000121435 Essential Splice Site 107 539 6 16
ENSDART00000126499 Essential Splice Site 108 745 4 14
ENSDART00000142439 Essential Splice Site 107 168 6 7
ENSDART00000146882 None None 87 None 2
Genomic Location (Zv9):
Chromosome 25 (position 7998132)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7610656
GRCz11 25 7734748
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTCACAGCCGATATCAGGCCCTCCACACAACCAGGGGGCGCCACAGG[T/C]ACCAGCTTAAAATCAGTGTGGCTTTTAAAATCTGATGTTTATTCTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18275
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021577 Nonsense 279 796 8 17
ENSDART00000121435 Nonsense 279 539 8 16
ENSDART00000126499 Nonsense 280 745 6 14
ENSDART00000142439 None None 168 None 7
ENSDART00000146882 None None 87 None 2
Genomic Location (Zv9):
Chromosome 25 (position 7990909)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7603433
GRCz11 25 7727525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGCACCACGCAACTCGCAGGCATCGTCATCAGCCCTGCCCAGACACTT[C/T]AGATCAGCAATCTTAACTCAGACWTGAAGGTGAGAGTACTTATTTGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3290
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021577 Missense 534 796 16 17
ENSDART00000121435 Nonsense 536 539 16 16
ENSDART00000126499 Missense 483 745 13 14
ENSDART00000142439 None None 168 None 7
ENSDART00000146882 None None 87 None 2
Genomic Location (Zv9):
Chromosome 25 (position 7985528)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7598052
GRCz11 25 7722144
KASP Assay ID:
554-2449.1 (used for ordering genotyping assays)
KASP Sequence:
TAGTGTAGGAGCACATCACAATCATATTTGTTTTGTCCCTGTCCAAAAAG[C/T]AAAAGAAGAAGAGAAGCAGAAGCTAATGAAATGGAGTGCTGAACTAAAGC
Associated Phenotype:
Not determined