Busch Lab

ZMP

slc30a2

Ensembl ID:
ENSDARG00000021305
ZFIN ID:
ZDB-GENE-041014-347
Description:
zinc transporter 2 [Source:RefSeq peptide;Acc:NP_001038485]
Human Orthologue:
SLC30A3
Human Description:
solute carrier family 30 (zinc transporter), member 3 [Source:HGNC Symbol;Acc:11014]
Mouse Orthologue:
Slc30a3
Mouse Description:
solute carrier family 30 (zinc transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:1345280]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43504 Nonsense Mutation detected in F1 DNA Not yet available
sa23776 Nonsense Available for shipment Available now
sa23775 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43504
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050474 Nonsense 30 398 2 8
ENSDART00000110307 None None 336 None 7
Genomic Location (Zv9):
Chromosome 20 (position 38635116)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38707528
GRCz11 20 38610407
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGAAATGGCGTCACTCTACCTCATGCTTTGTTCTTATAGTGAATTCT[C/A]AGGATCCAAAGAAAGTTGCCCAAACCTGCCTTTGGGAAATGGTGAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23776
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050474 Nonsense 78 398 2 8
ENSDART00000110307 Nonsense 33 336 1 7
Genomic Location (Zv9):
Chromosome 20 (position 38634973)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38707385
GRCz11 20 38610264
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGGAAAAAAGCAGCCTATGATGACAGCCGCGAGAAGCTCTTAGCCAAG[A/T]AGAAATTGTTCATCGCCTCCATAGTCTGTCTGGTTTTCATGATTGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23775
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050474 Essential Splice Site 197 398 5 8
ENSDART00000110307 None None 336 None 7
Genomic Location (Zv9):
Chromosome 20 (position 38626178)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38698590
GRCz11 20 38601469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCGATTGATTTGATCCGCATCTGTGCATTATTATTGTTTTAATTTTGC[A/C]GAATGGCCTACATTCTGCACCACTCCACAACCTTCCACAGTCACGGGTCA
Associated Phenotype:
Not determined