Busch Lab

ZMP

eif3d

Ensembl ID:
ENSDARG00000021257
ZFIN ID:
ZDB-GENE-030131-8442
Description:
Eukaryotic translation initiation factor 3 subunit D [Source:UniProtKB/Swiss-Prot;Acc:Q6TH15]
Human Orthologue:
EIF3D
Human Description:
eukaryotic translation initiation factor 3, subunit D [Source:HGNC Symbol;Acc:3278]
Mouse Orthologue:
Eif3d
Mouse Description:
eukaryotic translation initiation factor 3, subunit D Gene [Source:MGI Symbol;Acc:MGI:1933181]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15631 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15631
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011052 Nonsense 329 552 10 16
ENSDART00000132298 Nonsense 327 550 11 17

The following transcripts of ENSDARG00000021257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 29800117)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29518156
GRCz11 3 29648998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCGAAACCTGGCCATGGAGGCYACTTACATCAACCACAACTTCAGYCAG[C/T]AGTGTCTCCGCATGGTAYGCTTGAGGTTTTCCCCAGTATACTGATCATTC
Associated Phenotype:
Not determined