Busch Lab

ZMP

zgc:165604

Ensembl ID:
ENSDARG00000021241
ZFIN ID:
ZDB-GENE-070615-34
Description:
hypothetical protein LOC792578 [Source:RefSeq peptide;Acc:NP_001091725]
Human Orthologues:
C1orf204, ESAM, IGSF11
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
endothelial cell adhesion molecule [Source:HGNC Symbol;Acc:17474]
immunoglobulin superfamily, member 11 [Source:HGNC Symbol;Acc:16669]
Mouse Orthologues:
Esam, Igsf11
Mouse Descriptions:
endothelial cell-specific adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1916774]
immunoglobulin superfamily, member 11 Gene [Source:MGI Symbol;Acc:MGI:2388477]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29613
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024287 Splice Site None 298 7 7
ENSDART00000144869 Essential Splice Site None 298 None 7
Genomic Location (Zv9):
Chromosome 21 (position 26964506)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27533417
GRCz11 21 27570112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTTACCCGTGTATGTCACATAACCTGCTTTCTGGAATAGCCCCCAGT[A/T]GATGTGTTTATGCTCTGTAAAGGGACGTATAGTGGATATTATGTTTTCAT
Long Flanking Sequence:
TTCAGTGCCAGGCATACTGTACAGGTGGTCGTACTGCCACATTGTACAGTTGCCTAAAATGCCCTGACGCGAATACAAAGAGCTGCACTGAATGTTTTTTATGGTAAGCGCAGACCCGCGGTTTGTCACATTTGATTTCAAAAAGGTTTGTTAAATACATTAACATTATGAATTTGGTTATGAAAAAAACTATGCACTTATAACCCTCTCACAACGAAAAAACTTGTATCTGTGTGTCCACATCCATAAATATTCTCATCAAAAGAGCACGCAATGCTCAGTAAACTCTCTGAAACAGACAAACTCTGAAACATAGCAACTTACTCTCTGAACATAACCTGCTCCGGAGCAGGTTATCTTCAGAGAGTAAGTTGCTATGGCTACTTAACATACCCAGAAGTTACCTCCGATTTTGGAACCAAAGTTGAGGTTATCCACCTACTTACTCTCAAACTTACCCGTGTATGTCACATAACCTGCTTTCTGGAATAGCCCCCAGT[A/T]GATGTGTTTATGCTCTGTAAAGGGACGTATAGTGGATATTATGTTTTCATTAGCCACAAGTAATTTTTGTATTATATGATATACTACAATAAAATCTGGATCACTACATGACATTTTAGTTTACCTGAGAACAATGTTAAGGAAGTTACTTTAAAAAAGTACTTGCATTAAAATGGAAAAAAACAAAAATAGACTTTCACTTATGCCGACTGTTTTTTAAAGACCCTTGACAAGTTGTGATGCCCTTTTTTAGATTATATGCTGGCTTCTTTGAGCAATAATATATGAGTAATAATGAACAATAATATATGAATGCATATTTATTATTAATATTCTTTTTTTTTCTTATTTTATTTCTTTTATATTATTATTAATTTATTATTCATGTTTTAGTTTTTTTTAATAGGAAGTTATAGGCTGTTGAGGAAGGGAAGTTTTTATTTGAGGGAAGTGTCAACAACAACATGGAAGGATAATTAATAAATGAATGTTGTAATTGA
Associated Phenotype:
Not determined