Busch Lab

ZMP

rbfox1l

Ensembl ID:
ENSDARG00000021184
ZFIN ID:
ZDB-GENE-040923-2
Description:
Fox-1 homolog-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZT82]
Human Orthologues:
RBFOX1, RBFOX2, RBFOX3
Human Descriptions:
RNA binding protein, fox-1 homolog (C. elegans) 1 [Source:HGNC Symbol;Acc:18222]
RNA binding protein, fox-1 homolog (C. elegans) 2 [Source:HGNC Symbol;Acc:9906]
RNA binding protein, fox-1 homolog (C. elegans) 3 [Source:HGNC Symbol;Acc:27097]
Mouse Orthologues:
D11Bwg0517e, Rbfox1, Rbfox2
Mouse Descriptions:
DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed Gene [Source:MGI Symbol;Acc:MGI:10636
RNA binding protein, fox-1 homolog (C. elegans) 1 Gene [Source:MGI Symbol;Acc:MGI:1926224]
RNA binding protein, fox-1 homolog (C. elegans) 2 Gene [Source:MGI Symbol;Acc:MGI:1933973]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12116 Nonsense Available for shipment Available now
sa44854 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12116
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027364 Nonsense 55 382 2 12

The following transcripts of ENSDARG00000021184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34134784)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31957268
GRCz11 16 31912856
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAATGGTGATCCTTCACTTCCCCAGGTTTATGCCCCACCCCCTTCATA[T/A]CCTCCACCTGGACAAGCCCCGCCCACACCTGCTGCCCGACTGCCACCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44854
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027364 Nonsense 304 382 8 12

The following transcripts of ENSDARG00000021184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34126235)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31948719
GRCz11 16 31904307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCTCCGCAGCCGCCGCTGCCACACCAGCTGCAGTGCCAGCCTACCCA[G/T]GGTCAGTCTCTCTCAATGGAAAACTAATCACTGCAAGATATTTTAGATAG
Associated Phenotype:
Not determined