Busch Lab

ZMP

plekhf2

Ensembl ID:
ENSDARG00000021141
ZFIN ID:
ZDB-GENE-040426-884
Description:
Pleckstrin homology domain-containing family F member 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUV1]
Human Orthologue:
PLEKHF2
Human Description:
pleckstrin homology domain containing, family F (with FYVE domain) member 2 [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Plekhf2
Mouse Description:
pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene [Source:MGI Symbol;

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7803
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032389 Nonsense 5 247 2 2
Genomic Location (Zv9):
Chromosome 16 (position 43093334)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40476784
GRCz11 16 40426816
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCTTTTTCTCTCTTTTATTCCTAGGTGTCTGAAAGATGGTGGACCGCT[T/A]GGCGAACAGTGAGGCCAACTCTAAACGCATCGGGGTGGTGGAGGCATGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2879
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032389 Nonsense 91 247 2 2
Genomic Location (Zv9):
Chromosome 16 (position 43093077)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40476527
GRCz11 16 40426559
KASP Assay ID:
2261-0151.1 (used for ordering genotyping assays)
KASP Sequence:
ACAATAAGCAGCACATCATCCCTTTGGAGAGCGTCACCATAGACACGGTC[G/T]AGGACGARGGCGAATTGCGCAACGGCTGGCTCATTAAAACGCCCACCAAA
Associated Phenotype:
Not determined