Busch Lab

ZMP

tmem48

Ensembl ID:
ENSDARG00000021120
ZFIN ID:
ZDB-GENE-030131-7176
Description:
Nucleoporin NDC1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SZC5]
Human Orthologue:
TMEM48
Human Description:
transmembrane protein 48 [Source:HGNC Symbol;Acc:25525]
Mouse Orthologue:
Tmem48
Mouse Description:
transmembrane protein 48 Gene [Source:MGI Symbol;Acc:MGI:1920037]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14041 Nonsense Available for shipment Available now
sa13501 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14041
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025120 Nonsense 95 671 4 18

The following transcripts of ENSDARG00000021120 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26736215)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26932411
GRCz11 2 26588045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATTAACTTTTTTCTCTTCTCCCTCAAGTGGTTCCCTCAATTCCATGCT[C/A]GCGTGTGGCTCTTCTGGGRACGGTGCTTCACCCACTTCAATGTGTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13501
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025120 Nonsense 335 671 10 18

The following transcripts of ENSDARG00000021120 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26732422)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26928618
GRCz11 2 26584252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTTTGGCTCTGCAAGACCTGGCTTTATTGTCACAGCATTCTCCCTCA[C/T]GAAGACAGGAGGTTTTCAGTCTGAGTCAGCCAGGTGCAAACTAAAACCTT
Associated Phenotype:
Not determined