Busch Lab

ZMP

clptm1l

Ensembl ID:
ENSDARG00000021048
ZFIN ID:
ZDB-GENE-040718-75
Description:
Cleft lip and palate transmembrane protein 1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6DHU1]
Human Orthologue:
CLPTM1L
Human Description:
CLPTM1-like [Source:HGNC Symbol;Acc:24308]
Mouse Orthologue:
Clptm1l
Mouse Description:
CLPTM1-like Gene [Source:MGI Symbol;Acc:MGI:2442892]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3019
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004585 Nonsense 241 538 6 17
Genomic Location (Zv9):
Chromosome 19 (position 1986403)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1913143
GRCz11 19 1862998
KASP Assay ID:
554-3136.1 (used for ordering genotyping assays)
KASP Sequence:
TSGCAGGAGATCAACAGCAGCTCCACTGAGCTTCCTCTGACCATCACRTA[C/A]GACTCCATCGCTCTGGGCAAACTGCGCTTCTGGATCCACATGCAGGACGC
Associated Phenotype:
Not determined