Busch Lab

ZMP

foxd3

Ensembl ID:
ENSDARG00000021032
ZFIN ID:
ZDB-GENE-980526-143
Description:
forkhead box protein D3 [Source:RefSeq peptide;Acc:NP_571365]
Human Orthologue:
FOXD3
Human Description:
forkhead box D3 [Source:HGNC Symbol;Acc:3804]
Mouse Orthologue:
Foxd3
Mouse Description:
forkhead box D3 Gene [Source:MGI Symbol;Acc:MGI:1347473]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20726 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20726
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017695 Nonsense 41 371 1 1
Genomic Location (Zv9):
Chromosome 6 (position 31785647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32106563
GRCz11 6 32093477
KASP Assay ID:
2259-7693.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCGACGTGGTCGGGGAGGGTGACGAGGGGATGGAGCAGGACAGTGACTG[C/A]GAAAGCCAGTGCATGCAGGACCGGGGAGATGAGGTGGAGGAGATCGAGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa174
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017695 Nonsense 44 371 1 1
Genomic Location (Zv9):
Chromosome 6 (position 31785640)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32106556
GRCz11 6 32093470
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTCGGGGAGGGTGACGAGGGGATGGAGCAGGACAGTGACTGCGAAAGC[C/T]AGTGCATGCAGGACCGGGGAGATGAGGTGGAGGAGATCGAGGTGAAGGAG
Associated Phenotype:
Not determined