Busch Lab

ZMP

slc16a10

Ensembl ID:
ENSDARG00000020984
ZFIN ID:
ZDB-GENE-040724-214
Description:
Monocarboxylate transporter 10 [Source:UniProtKB/Swiss-Prot;Acc:A1L1W9]
Human Orthologue:
SLC16A10
Human Description:
solute carrier family 16, member 10 (aromatic amino acid transporter) [Source:HGNC Symbol;Acc:17027]
Mouse Orthologue:
Slc16a10
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 10 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36926 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36926
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104762 Nonsense 219 505 3 7
ENSDART00000131635 Nonsense 219 354 3 4
Genomic Location (Zv9):
Chromosome 20 (position 153980)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 144575
GRCz11 20 133210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGGCATCGTGACGGCGGGCAGCAGCGTGTTCACCATCACGCTCCCGTA[C/A]ATGCTGTCGGGCCTGCTGAAGAGCGTGGGGCTGTACCACACGCTGCGGGT
Associated Phenotype:
Not determined