Busch Lab

ZMP

si:ch211-214j8.1

Ensembl ID:
ENSDARG00000020952
ZFIN ID:
ZDB-GENE-060526-100
Description:
N-acetylated-alpha-linked acidic dipeptidase-like protein [Source:RefSeq peptide;Acc:NP_001091660]
Human Orthologue:
NAALADL1
Human Description:
N-acetylated alpha-linked acidic dipeptidase-like 1 [Source:HGNC Symbol;Acc:23536]
Mouse Orthologue:
Naaladl1
Mouse Description:
N-acetylated alpha-linked acidic dipeptidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2685810]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa33603 Nonsense Mutation detected in F1 DNA Not yet available
sa7565 Missense Mutation detected in F1 DNA Not yet available
sa14612 Nonsense Available for shipment Available now
sa33604 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Nonsense 109 740 2 19
Genomic Location (Zv9):
Chromosome 5 (position 27893488)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25648786
GRCz11 5 26248939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCCCAAAACAGGCTTGGACAGTGCATGGAGGGAGGACTACAAGGTGTA[T/G]CTGTCATTTCCAAACAAGGATAATCCTAACAAAGTCTCTGTTGGTAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26476
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Essential Splice Site 267 740 5 19
Genomic Location (Zv9):
Chromosome 5 (position 27896980)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25652278
GRCz11 5 26252431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACAACATTGACTTTGGAGACTTGTTAACACCTTACCTAGCTGCAAAAG[G/A]TAACCAGAGCTTTTTAATGAATTGATTTGTTTTAAAATGTATTGCATTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26477
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Nonsense 341 740 8 19
Genomic Location (Zv9):
Chromosome 5 (position 27897482)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25652780
GRCz11 5 26252933
KASP Assay ID:
2259-5848.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTAATAATGTTTTGTTCTGTCCTTTAGCACTGTGCATTTGGACACTTA[T/G]AACATTGAGAAAATAGAAAACTCAGCTAATGTTATGGGAGTGATCCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7565
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Missense 457 740 12 19
Genomic Location (Zv9):
Chromosome 5 (position 27899731)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25655029
GRCz11 5 26255182
KASP Assay ID:
554-4347.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGTTYGCACTGCTGAAATGTTCTTTGTCCACAACAGCTAATGCCACTC[T/C]CAGAGCCTCAGCTTCTCCAGCAGCACAGAGTGTGCTTTTTACCGCCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Nonsense 495 740 13 19
Genomic Location (Zv9):
Chromosome 5 (position 27899931)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25655229
GRCz11 5 26255382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCCGGGACAACCATGTCAGTCTATGACAACTGGATACGGTATTACAAC[A/T]GAACCAGTCCAAATTATGGGATTATACCWAAGTATGCTCWTAAWTTTATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33604
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Essential Splice Site 505 740 13 19
Genomic Location (Zv9):
Chromosome 5 (position 27899964)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25655262
GRCz11 5 26255415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATACGGTATTACAACAGAACCAGTCCAAATTATGGGATTATACCTAAG[T/C]ATGCTCTTAATTTTATTCAGTACCACCTCATAGTTCAGCTTTTAATACAC
Associated Phenotype:
Not determined