Busch Lab

ZMP

tmod4

Ensembl ID:
ENSDARG00000020890
ZFIN ID:
ZDB-GENE-991019-9
Description:
tropomodulin-4 [Source:RefSeq peptide;Acc:NP_571271]
Human Orthologue:
TMOD4
Human Description:
tropomodulin 4 (muscle) [Source:HGNC Symbol;Acc:11874]
Mouse Orthologue:
Tmod4
Mouse Description:
tropomodulin 4 Gene [Source:MGI Symbol;Acc:MGI:1355285]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
hu3530 Nonsense Confirmed mutation in F2 line Not yet available
sa18609 Nonsense Available for shipment Available now
hu3476 Missense, Splice Site Confirmed mutation in F2 line Not yet available
sa22870 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3530
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
Genomic Location (Zv9):
Chromosome 16 (position 31913353)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29732716
GRCz11 16 29667339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATAGAGCATAAGGATAGAGATGACCTGGTGCCTTTTACAGGGGAGAAG[A/T]GAGGTACCATCACTACTGGACAGATATTATGAACATGATCGTTCATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18609
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
Genomic Location (Zv9):
Chromosome 16 (position 31913353)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29732716
GRCz11 16 29667339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATAGAGCATAAGGATAGAGATGACCTGGTGCCTTTTACAGGGGAGAAG[A/T]GAGGTACCATCACTAYTGGACMGATATTAWGAAMATGATCGTTCATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3476
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Missense, Splice Site 89 343 3 9
ENSDART00000137153 Missense, Splice Site 89 343 4 10
Genomic Location (Zv9):
Chromosome 16 (position 31917221)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29736584
GRCz11 16 29671207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCACGGTAACAACAGTGTGTATCTTTTTTCTCCACTGCTGTCCGTAG[G/A]GAAAGCCTTCGTTCCTAAACCAGGCTCGGGACAAATCCCAGCGGACGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22870
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Nonsense 171 343 5 9
ENSDART00000137153 Nonsense 171 343 6 10
Genomic Location (Zv9):
Chromosome 16 (position 31922593)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29741956
GRCz11 16 29676579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTTTATTCTCTTTCAGGTGTGGTGAAACCAGATGTGTATAAAATCTA[T/A]CCTGAGGAGCCTCCCAATGACACCAACGTGGAGGAAACTCTCCGCTACAT
Associated Phenotype:
Not determined