Busch Lab

ZMP

si:ch211-148j1.1

Ensembl ID:
ENSDARG00000020845
ZFIN ID:
ZDB-GENE-030131-6933
Description:
Novel protein similar to vertebrate tensin 1 (TNS1) [Source:UniProtKB/TrEMBL;Acc:B0R0Y9]
Human Orthologue:
TNS1
Human Description:
tensin 1 [Source:HGNC Symbol;Acc:11973]
Mouse Orthologue:
Tns1
Mouse Description:
tensin 1 Gene [Source:MGI Symbol;Acc:MGI:104552]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa45379 Nonsense Mutation detected in F1 DNA Not yet available
sa7213 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa27484 Nonsense Mutation detected in F1 DNA Not yet available
sa17234 Nonsense Available for shipment Available now
sa10585 Essential Splice Site Available for shipment Available now
sa27483 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3719
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 228 1769 8 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48645066)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47866574
GRCz11 9 47563969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTTGGATGAACGCTGGCAGTCACAACGTGGTGGTCATACACAACAAGG[T/A]ACTGTWTTGCTATCAGAATTGAAGCTTTTTTCACTAAAAAAAGGNCATGTA
Long Flanking Sequence:
TATTGTTTATTATATGCTTTATTTTATAATAATTCAATAGCAATGGTGTGTTTTTGTGTATTGTTTATTATTTTGATTTTATTATACAATAATATTTAATCATTATATTAATTCATTAATTATATAATTTGTTTTAATTATATTTTATCATATAATTAAATATTATTTAATCTTTTTAATCATATAATTATTTTTGCAGCTCTTCAACCTCAGTGAAAAGCGCTTGGATATCTCCAAGCTGAATCCCAAAGTGAGTTTTATTTAACTGGATGGGTGTTTATTTATTTATTTTAATTTTTTTTATTTTTTGCTGGCCGATGTTGGTGTTTGTTCCTGTGGTCTTACTTTGGTACTGTGGTGTGTTTTTCTGTGTGAGGTTCTGGATTTTGGCTGGCCGGATCATCACGCTCCTGCTTTGGATAAGATCTGCAGCATCTGCAAAGCCATGGACACTTGGATGAACGCTGGCAGTCACAACGTGGTGGTCATACACAACAAGG[T/A]ACTGTTTTGCTATCAGAATTGAAGCTTTTTTCACTAAAAAAAGGCATGTATGGAAAAAAAATACTAGTCTGTGTTGTGAGGTAGTACAAGTGCATTACTGAGTTTGACAACTGTGCATTAGATGGTCCCATACATTATAGCATATAGACACAAAATGGTTTTAATAAGTACAGGTAAGAATTAGCGTGCTGTTTAATTTTTACATTCATACTATACATGCTGGTTGATTATGGAGTGTTTTTTCACCCATATTTTCTTTTCTTTTATGGTATTTGAAACATTAAAGTAGTCACTTTACTTTTATATAAGTCAAGTTAAATGAGTCAAGACAAGATTTTATGTGAAATAAATAAAATTAAATAAAATTAAATAAAATTAAATTAAATACTGGCAACTCATTACCTAGTAGAAGTACCATTGTTTATATGGCCAAATCATAGAATATATAGTTGCTAATTATTATTCAAAATAATATCAAGGATAATAATAATTAATTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45379
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Nonsense 273 1769 10 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48636452)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47857960
GRCz11 9 47555355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGTTTGCCATGAAGAGGTTTTATGAAGATAAAGTGCTTCCTGTGGGT[C/T]AGCCTTCCCAGAGAAGGTCAGTGCTGCTTTGTTTTCCTCATCTGACCTCT
Long Flanking Sequence:
AGTACGCTAAAATCAGTATGCGAGCCGAGTAGTATGTCCGAATTCATAGAATTCGAAAATCAGTAGGCGAGAAGTTCCCGGATGACTTACTACTTCCGGCGAGATTCTGAAGTGCGCATCCCATGCACGCTGCACTATCCCATAATGCCCCGTGAGAAAATTCATGAATGGAAGTGAGGCGACGCAACTGACGCAGGTAGGTCACGTGACCATGATAAAATGGCGGATGTAGTACGTCCGAATTCCATTCATACTTTTCACATTCATACTGTATAGAACATACTTTTCTGACGGCCGAGTAGTACGTTTAAATTCAAATGCAGTACCTACTGAGTAGTAGGCGGTTTCGGACGCAGCCAATGATATTTTTGTTGTTTTTGTTCAGTTCACCCGAATATCTGCAATAACACTAGTGTCTGCTTTGTCTCTGCAGTGCCGACCAGGCTCTGGACAGGTTTGCCATGAAGAGGTTTTATGAAGATAAAGTGCTTCCTGTGGGT[C/T]AGCCTTCCCAGAGAAGGTCAGTGCTGCTTTGTTTTCCTCATCTGACCTCTTATCTTTCTGCTTTATGAGTTTGACCCTCATTGTAAGTGTTGGGTTTCAGCCATTGTTCACATTTATGAGCTTCGCTCAATGATAACTGCAGCACAAACATGCAAACCAATGCTTCGTCTAGTTCTGATAGGTGGAGTTATGTGTTGTTTACCTGAATGTGCCCTACAGCAGTGTGCTGGGGACTTCAGATTAATTATACTTTGCATGATGTTGCACGATTAGCTTTATGAGCACCTCACCACATGCCTCAGAGCTGGCACTGTCTTATATGCAAATGATGCAATTTATAAACTCAGAAATGCTATATTTATAGGGCGTCAAGGTGGCGAAGTGGGTAGCACGGTCGCCTCACAGCAAGAAGGTCGCTGAATCGAGCCTCGGCTTGGTCAGTTGGCATTTCTGTGTGGAGTTTGCATGTTCTCCCCGTGTAGGCGTGGTATCCTCTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7213
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 361 1769 13 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48630200)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47851708
GRCz11 9 47549103
KASP Assay ID:
554-4396.1 (used for ordering genotyping assays)
KASP Sequence:
TATCTGCATCACYATTGAACCGGGCCTGCTTYTGAAAGGAGACATACTGG[T/C]AAGAATAAGGRAATATACSGCATACGCAGTTAAAGTCAGTATTAWTACTG
Long Flanking Sequence:
GAGTTTAGAAACAGCATTTTACTTGTAGTTGACATGTAGAGCTCTAGTAACCCTTTGTTTTGTCCTCCTTCTCTTGGTTTCTCAGGTTGCCGCCCTTTCCTGAAGATCTACCAGGCCATGCAGCCCGTCTACACATCTGGCATCTAGTAAGAAACACCCCATGTTTTCCTACACGCCATTGCTCAGGCTTCCCTGGCCAGAAGCCCAGCCATCAGGACGTACACACACACACACACACACAGGAGCCCACATGTGCTTTTCACATACAGATCTCAGCTTCTCCAGCTCTCAGACTGCAGCTGTCAGGATAATCCTTTTAGTTTTTTGCATTGATCACTCTTATGTTTAGACTCACATTTGTGTATTATTGAGGTTAACACATGTGTGTGACTGATGTTTTTGTGTGTGTTTGTTTGTTCACAGTAATGTCCAAGGAGACAGTCAGACTAGTATCTGCATCACCATTGAACCGGGCCTGCTTTTGAAAGGAGACATACTGG[T/C]AAGAATAAGGAAATATACGGCATACGCAGTTAAAGTCAGTATTAATACTGTGAAAAACTACTTGCTTTGCACATGTTGTCTTCAAAGTGGTGAAGAAAGAGTTAACAGACAAAAACATTAACATTTTACAGTGGCCCAGCCAGAGTCCTGACTTAAATCCAATTGAAAATCTGTAGGGGGAGCTAAAGATCAGGGTGAATGCATGGACAGCATCCAAATTGAATGAGTTGGAGCTCATTGCTAAACATAAATCGGCAAAAATGCCAGTGGAGACGTGCAAAAAGATGGTCAGCAATTATAGGAAGCGTTTGATTGCTGATATTTCCAATAAGGGATTTTCTGCTGATTATTGAGTGGTATAAATATTTTTGCTTTATCATACTGTATACTAATAATGATAATAACCTCACACCAAAAATGCTCTGTATTATTATGTTAGTTTATGTAATTTAATAATTGCCAATTCATTTATCATGCAAACACAAAACTAATAATAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27484
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Nonsense 396 1769 14 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48625686)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47847194
GRCz11 9 47544589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTTCAGTTTCACACCTGTGCTGTTCATGATCTGGGTATCGTCTTCGGC[A/T]AAGATGAGCTTGATGAAACCTTTAAAGGTATGCTTTATTTTATTTTATTT
Long Flanking Sequence:
GCAAAACCAGAAATGCAGCCACATAGAAAAATAGAAAATGTTTTGTTTTGATTTACTTTTGTTTTAGTCGTTGTTTAAATATACAGTATATTTATATATTATATATTATGTTTGATGTTTACATGTGTAGATCTTAGAAATCCAAAAGTACTGGTGCTTTATTTAAGTTAATACAAACTTTATTGATTGGTTTATTGAAAATAATAAAAATAATAATAATAGTTGTTGTTGTTTTTATTATTAAATGTAATAATTTACTGTATAGTAAATTATTACATTTAATTATTACATTTTATAATCAGATAACATAATAATATGACAATCTATATTTATTTACATAATTGATATATTAAAAGGTTTGTTCATTGATCATTTCTCATTTCTTGTGTGTGCCACAGCTAAAGTGTTATCACAAGCGTTTCCGCAGCCCATGCCGTGATGTCATATTCAGAGTTCAGTTTCACACCTGTGCTGTTCATGATCTGGGTATCGTCTTCGGC[A/T]AAGATGAGCTTGATGAAACCTTTAAAGGTATGCTTTATTTTATTTTATTTTATTTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTAAGATATTCAATTATTTATTTTGAGTTTAATTTAATATAATAATTTTGTTTACTTTTTATTTAGTTTTTATGTATTGATTTATACATTTATTTTTTTATTTTATTTTTTTCAGTTTAGTTTTGTTTATGTATTTATTTATATACTTTTAAATTATTATTCGTTTTATTTTTATTTTTCATTTTAATTTAATTTTTAATTTATTTTAATTAATTTTAATTTTAATTAATTAATTTATTATTTATTTATTCTTTTATTTATTTAATTTCAGTTCAGTTTAGTTTTTATTTATTTATGTATATATTTTATTTTTAATTTTCATTTAAATTTTATTGTTAATTTTATTTTTAATTTAATAAAATTTTATTAAATAATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17234
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Nonsense 771 1769 17 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48583144)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47804803
GRCz11 9 47502198
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTACTACAATCCCACAGCCTTCCAGAGTTCCCTCAGATGGCATCTCAA[C/T]AAGAGATTGAGCAGTCCATTGAAGCCCTCAAMATGCTGATGCTGGACCTT
Long Flanking Sequence:
ATGGACACAGCAACATAGACAGAGAGACAGATATCCTTGATGATGACTTGCCCATCAGCCAGGAAGGGAACAGTGTGGACAGTCTTGGAACTCTCTCATCTTTTGAGGGCAGAGCCACTCCTGCGGATCTATACTACCAGTCAGAGACAGTCATTAATGGACAAGATATGCCCTACTTAGAGAAGAGTGTCCATGAGAAAATGCTAGAGCCCAGAGTTCACAGCTCATCATCTGTCCAAGAGCACTTGGGAGCCCCTAGTGGGTATGCTAACCAGAATGGCAACATCTATCGATCTCAGTCATTAGGAGCAACCCCGAACACAGACCAGAAGTACATGCCCAAAGCTCCAGCACGCACAACCAGCAGTAGGGATGCCGTGCAGAGACTGAATGTTTGGCAACAATTTGGTGTACCAGAAGTCCCAGTCACAGATGGGGTCACCTTCAACCCTGTACTACAATCCCACAGCCTTCCAGAGTTCCCTCAGATGGCATCTCAA[C/T]AAGAGATTGAGCAGTCCATTGAAGCCCTCAACATGCTGATGCTGGACCTTGATCCAGCACTTACTCAAGTCCCCAAATCCCACAGCGCTCCATCTGGAGAAAGTGGTGTGGTCACCACCCAACCATCTTTCTCTCAAACCCAAGCACGCCCATCCTACCAGGCTGACACTGCTATTCATGACCGCGGTGCGGCCTCTTCAATGGGATTTCCTTTGACCTTTCAACAAGTAACTGGAGAGCCTTCACAACCCACCATGAAACAGCAGAAACCCACAACTACATCCCAGCATGTCGAATTCGCTTCTGAAGCAGGAGGTCAGGCCCCCATGTCCCAGTCCACAGTGCCTTCCTCCACCTTTGGAGTTCTCCAGTTGAAACCCCTCAACATTTATCCCTCAAGTACCACATCCCAGTCCCCCGAGCCTCAGGAGACTCAGCGTAGCTACTCTTCTTCCTCATCCCCTCTTCCCAAAGAGTCTGAACCAGAAGATAGCAGCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5573
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Nonsense 860 1769 17 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48582877)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47804536
GRCz11 9 47501931
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YCTTTCAACAAGTAACTGSAGAGCCTTCACAACCCACCATGAAACAGCAG[A/T]AACCCACAACTACATCCCWGCATGTCGAATTCGCTTCTGAAGCAGGAGGT
Long Flanking Sequence:
CTAACCAGAATGGCAACATCTATCGATCTCAGTCATTAGGAGCAACCCCGAACACAGACCAGAAGTACATGCCCAAAGCTCCAGCACGCACAACCAGCAGTAGGGATGCCGTGCAGAGACTGAATGTTTGGCAACAATTTGGTGTACCAGAAGTCCCAGTCACAGATGGGGTCACCTTCAACCCTGTACTACAATCCCACAGCCTTCCAGAGTTCCCTCAGATGGCATCTCAACAAGAGATTGAGCAGTCCATTGAAGCCCTCAACATGCTGATGCTGGACCTTGATCCAGCACTTACTCAAGTCCCCAAATCCCACAGCGCTCCATCTGGAGAAAGTGGTGTGGTCACCACCCAACCATCTTTCTCTCAAACCCAAGCACGCCCATCCTACCAGGCTGACACTGCTATTCATGACCGCGGTGCGGCCTCTTCAATGGGATTTCCTTTGACCTTTCAACAAGTAACTGGAGAGCCTTCACAACCCACCATGAAACAGCAG[A/T]AACCCACAACTACATCCCAGCATGTCGAATTCGCTTCTGAAGCAGGAGGTCAGGCCCCCATGTCCCAGTCCACAGTGCCTTCCTCCACCTTTGGAGTTCTCCAGTTGAAACCCCTCAACATTTATCCCTCAAGTACCACATCCCAGTCCCCCGAGCCTCAGGAGACTCAGCGTAGCTACTCTTCTTCCTCATCCCCTCTTCCCAAAGAGTCTGAACCAGAAGATAGCAGCTACAAATTGGAGGGTCTTGTAGCTCACCGTGTAGCTGGTAAGATCAACCTCGAAATACCTTTTTAACAGTCAGTTTTCTTGCTCATATGTGCATTTCTGATGGTTTGTTGATCAATAAAAACATGTGCTAACTAGTTAAGACTTTTAACTATTAGGCTGCAATGCTTTATCAGATTTTTTAAATGTAGAAAATGCTAATTGCGTAATTATGTCATTGGAACTATAGTACAGGAATTCATCTCTATGTTTGAGTGCTTAAGCTAAGGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 949 1769 17 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48582608)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47804267
GRCz11 9 47501662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGRTAGCAGCTACAAATTGGAGGGTCTTGTAGCTCACCGTGTAGCTGG[T/C]AAGATCAACCTCGAAATACYTTTTTAACAGTCAGTTTWYTTGCTCAYATG
Long Flanking Sequence:
CTGATGCTGGACCTTGATCCAGCACTTACTCAAGTCCCCAAATCCCACAGCGCTCCATCTGGAGAAAGTGGTGTGGTCACCACCCAACCATCTTTCTCTCAAACCCAAGCACGCCCATCCTACCAGGCTGACACTGCTATTCATGACCGCGGTGCGGCCTCTTCAATGGGATTTCCTTTGACCTTTCAACAAGTAACTGGAGAGCCTTCACAACCCACCATGAAACAGCAGAAACCCACAACTACATCCCAGCATGTCGAATTCGCTTCTGAAGCAGGAGGTCAGGCCCCCATGTCCCAGTCCACAGTGCCTTCCTCCACCTTTGGAGTTCTCCAGTTGAAACCCCTCAACATTTATCCCTCAAGTACCACATCCCAGTCCCCCGAGCCTCAGGAGACTCAGCGTAGCTACTCTTCTTCCTCATCCCCTCTTCCCAAAGAGTCTGAACCAGAAGATAGCAGCTACAAATTGGAGGGTCTTGTAGCTCACCGTGTAGCTGG[T/C]AAGATCAACCTCGAAATACCTTTTTAACAGTCAGTTTTCTTGCTCATATGTGCATTTCTGATGGTTTGTTGATCAATAAAAACATGTGCTAACTAGTTAAGACTTTTAACTATTAGGCTGCAATGCTTTATCAGATTTTTTAAATGTAGAAAATGCTAATTGCGTAATTATGTCATTGGAACTATAGTACAGGAATTCATCTCTATGTTTGAGTGCTTAAGCTAAGGTTGTCTTAAAAGCTGCCTTTTACATTGAAGGCGGTGCCTTTTTTGGTGGAGTTTCTTTGTAGTCAATGACAGAAGCACTGTGAGATCACAAAGAAAGCTTTGTCCAAAGTGCTTCTGGCCTAAGCCTCAGTATCAGACCACATTTCTTTTTTTGTGCCAAACCAAAACTGAACATTTGTACATCACATCTGGAAAGATGCCCAAAGAACTGAGGGCTGTTATAGAGCAGTGTACTTTTTTTCTGTTTAAATTATCTGTTCAGCTTAAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 1056 1769 19 31
ENSDART00000134480 None None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48564724)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47787432
GRCz11 9 47484827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAACCCCTGCCTTCCCTGTCTCGCCACAAACCCCTTACTTCAACATGT[G/A]TAAGTTCCCAATTTGGAGGAGGAGGGCGCCATAGAGCTCTAGAATAAGTC
Long Flanking Sequence:
AATTTCAAGCGTGATGAATGTGCTTCTGCAGGGCCTAATAGTTATCTCTCACATAGCTGATGACATCGTGTATTTGTTTTCTTGGCAGGACTTCCATCTGGTGAAATGTCGCCAGATGAGGCTGCAGTTCCTGGACGCTGTCGGACCCTTAGTGAGGGCCTTTCCCAAGACGAAAGCCCAACTCGAGGAAGCTCAGTCCGCTCCCCCATTCGCTGCATCTCACCAGAGCTGGCCAATACAATTGCTCTGAACCCTGGGGGGCGGCCCAAGGAGGTACACATCAATTATCCCTAAAACCAATCTCAGAATTAGCATGTGTGTGTGCAAATGGATACGTCTCCACTTGTTTTTCTTTTTCCAGAGGCACATGCACAGCTACAGAGAAGCGTTTGAGGAAATGGATGGGGGTCCCGTTAGCCCCCCTCCAATTGTTGGTGGTGAGGTCCTACCCCAAACCCCTGCCTTCCCTGTCTCGCCACAAACCCCTTACTTCAACATGT[G/A]TAAGTTCCCAATTTGGAGGAGGAGGGCGCCATAGAGCTCTAGAATAAGTCTATGCCAGTGCTTTAGGACAGATGTGTCATAACCTGCTCATATAGGACCACTCCACCCTACAAAGGCAAAGTGCGACAACTACACATTTGGTCAACATTGAGTTAAAGCCTAATATGGGCATCGTGACAAGTCTTCTTGTCCCATTTCAGAAAAAAAAAACAAGAGTTCCAAAATTGCATTAGCTACGAAACCTGAACAGGTGTAATAAAAAAGGTTAAGTTCAGTTTCAGTGTTTGCTTAGATATTGCATTTTGCCTTTGTAGGATAAGGGGACTTGGTGGTTTGAGCATTGGTCCTTTGGGAGCAGAATTGGAAATCTTCCACAACTATTGCTGAATTTTGGTTGTGTTCATTTCTCTGGGAAAAAATGTGAAAATGAAGCAAGCAGCTATTACGGGGCAGATCTTTATCCTTATAAACAGGCTATGTTATGAAACATAGTGAACTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5572
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Nonsense 1297 1769 22 31
ENSDART00000134480 Nonsense 241 722 3 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48544627)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47767833
GRCz11 9 47465228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACCCAGGGGATTCAGAGTAGTCCAATTCTCAGCAGGCAGCCAATGGGA[C/T]AAGCTGTCCAGAGCAGTCCAGTCCTCAACCGACAGGCATCCCTGAATCAA
Long Flanking Sequence:
ATTTTATTTGTTTGTTTCTGTGTTCTTTTAGTGAAAGCACATTGGCTGACAGCGGGGTCGGGATGAATTCTTTATCCCAGGCTGCTGTCGACATTTTCCATTTCCAGCCCTCCGAAATCCCATACCAACCACCACCACCCCCCTACCCAACCTCCATGTTGGGTAGCTACATCAGCCCTTCTCCAGCAGAGGCCATGCAAAATAATACCACCACCATCCAGCCACTTTCTGGAAGTCCTGGGACAAGACACCACACCATCCTTTCTGACATGGCGTCCGTTCCCAACTTTCAACACAGATTAGCAAATCAGGATGGTCCCATACTTGGGCGACAGCAGGCTCCAGCTAATGGTCATGTGCCTGGAATTGCTGGTAGTCCAGTGCAAGGAAGACACACTATGGTGTCCCAGGGTACACAAAGCAGTCCCATACTGAGCAGACAGTATCCTGTCACCCAGGGGATTCAGAGTAGTCCAATTCTCAGCAGGCAGCCAATGGGA[C/T]AAGCTGTCCAGAGCAGTCCAGTCCTCAACCGACAGGCATCCCTGAATCAAGCAAACCAAAGCAGTCCAGTGTTGAGTAGACAGCAGTCCATTACCCTACCCAACCAAGGCAGCCCGGTCCTAAGCAGACAGTCCTCGCTTAGTCATCCCAGTCAGGGTAGTCCTGTACTAGGACGCCACCCTTCCCTAACACAGGGTAGCCCCAGCCTGGATAGGCATCCGATGTACAGCGGTTACACCACTCCAGAAGAGCGACACGGAGCTCTGTCACGCCAAAGCAGCTCTTCAGGATACCAGCCGCCATCTACACCGTCTTTCCCAGTTTCTCCAGCAGGATACATCGAGGGAGCGGGATTCAGACAGGGGAGTCCTGCTTTCCAACCTCAGTTGCCCGAAAAGAGACGCATGTCCAGCAGTGACCGCACCAATGGTGGCCTGTCCTATGGGACGCTCAATGGGAAGATGTCCTCACCGGTGTCCAGTGGCGGCAGCACTCCGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7212
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 1633 1769 27 31
ENSDART00000134480 Essential Splice Site 577 722 8 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48528961)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47752167
GRCz11 9 47449562
KASP Assay ID:
554-4450.1 (used for ordering genotyping assays)
KASP Sequence:
GATCGCAACACCAACCAACCCGGCGGCAGATATGCTCAAGCAGGGCGCAG[G/A]TGAGAAAAACACATTACTGATTGTGGAAAATGAATCATTTGTGGCATTTT
Long Flanking Sequence:
CAAGATGCAATAATGTCTTAAATATATAACAATATGACTAGAAGCATGTTTTTTCTCTACTAATCTCATTCCTTTGTATGTATGCATGTGTTTTCTATACTTGGACTTTCATTATGACCTCATTTATCTGTGTCCTTGGTCATGATGATGTATGTCCTGTTTGTCTAGTGTGAATAATTGTGAACATTCATCCTCGTTTAGTCCTCTGTCCTCAGCCAACTGCTATATGCCATTCAGGTGTCAAAGGGCACAAAGCCGCAGACCTTTACGTGTGGATTTCCGCCTTTTCAAACACAGTGTGACGGCATGTTTGCCAGACGCTTTGATTACTGGCATAGTATGCATTCCTGCAGGCGAACGACAGGTTATAACACTCAGCCTGACAGGATGTGCTCAGTTTGACCTCTGACCTGCGCTCATGTTTGCAGATCCTCTGGAAGAGTCACCTGAGATCGCAACACCAACCAACCCGGCGGCAGATATGCTCAAGCAGGGCGCAG[G/A]TGAGAAAAACACATTACTGATTGTGGAAAATGAATCATTTGTGGCATTTTTTAATGATTTCTCTCTGATAGTGTGATGCTTTAGATTCTAATTAAGATCTTCTGTTGCGTTTTGAAAAATTAAAAATAAAAATATATTTGAAAATACATTTTTTATTAAGATTTTATTTATAAAAAAGCAATAATTACAGTTACAGTAAGGCTCTTCCAGAAGAGCAATTCTATTAAAATGACAATTGTGGCCAAATAAAGAGTTGCATAAAATTAAAATCTATTCAAATATGTGGTCATTTCAAAACACTTATTTAAAATAAAAATACATTTTAAATTAAGTTTTATTTAATAAAAAACAATAATTACAGTAAGGCTGTTCCAGAAGAACATTTATAATAAAATGGCATTTAAAGAGTTGCATAAATTTATTAAAATGTAGAGTCACAAAAATCGTATTGTTATTATATATTATATATTATATATGAGCAATATCACACGACTACCAGT
Associated Phenotype:
Not determined