Busch Lab

ZMP

ap1m1

Ensembl ID:
ENSDARG00000020838
Human Orthologue:
AP1M1
Human Description:
adaptor-related protein complex 1, mu 1 subunit [Source:HGNC Symbol;Acc:13667]
Mouse Orthologue:
Ap1m1
Mouse Description:
adaptor-related protein complex AP-1, mu subunit 1 Gene [Source:MGI Symbol;Acc:MGI:102776]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30346 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24748 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30346
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053427 Essential Splice Site 182 359 5 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3497 (position 100627)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17604593
GRCz11 2 55437145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGAAGAACGAGGTTTTCCTGGACGTCATCGAGTCCGTTAACCTCCTGG[T/A]ATGTTTTTAGAAGCACCACGGTTCTTAGATGTCTGCAGACATTCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24748
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053427 Nonsense 246 359 7 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3497 (position 103168)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17607134
GRCz11 2 55439686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCGGTGGAGTTAGAGGATGTGAAGTTTCATCAGTGTGTGCGTCTATCT[C/T]GATTTGAGAACGATCGCACCATCTCCTTTATTCCTCCCGATGGAGAGTTT
Associated Phenotype:
Not determined