Busch Lab

ZMP

sla2

Ensembl ID:
ENSDARG00000020788
ZFIN ID:
ZDB-GENE-080204-98
Description:
src-like-adapter 2 [Source:RefSeq peptide;Acc:NP_001107907]
Human Orthologue:
SLA2
Human Description:
Src-like-adaptor 2 [Source:HGNC Symbol;Acc:17329]
Mouse Orthologue:
Sla2
Mouse Description:
Src-like-adaptor 2 Gene [Source:MGI Symbol;Acc:MGI:1925049]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32431 Essential Splice Site Available for shipment Available now
sa8830 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32431
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005072 Essential Splice Site 64 264 3 8
ENSDART00000134659 Essential Splice Site 64 264 4 9

The following transcripts of ENSDARG00000020788 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14930238)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15062171
GRCz11 23 14818248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGGCGACTGCGCCATTAGAGTCGGAGAACGCCTCAACATTCTGTCAGAG[T/C]AAGAGCACTGATACACAACACAACATGAGTCTGATCAGGGTTATACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8830
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005072 Essential Splice Site 177 264 6 8
ENSDART00000134659 Essential Splice Site 177 264 7 9

The following transcripts of ENSDARG00000020788 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14923969)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15055902
GRCz11 23 14811979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTGGACTCACCTTCAGGACCCTCTCAGACATGATCGCGCACTATTCAG[G/A]TACAGTACACACTAACACACACTTCATTGACACTTATTGSCTGGGTCATT
Associated Phenotype:
Not determined