Busch Lab

ZMP

slmap

Ensembl ID:
ENSDARG00000020764
ZFIN ID:
ZDB-GENE-040426-809
Description:
sarcolemma associated protein [Source:RefSeq peptide;Acc:NP_956471]
Human Orthologue:
SLMAP
Human Description:
sarcolemma associated protein [Source:HGNC Symbol;Acc:16643]
Mouse Orthologue:
Slmap
Mouse Description:
sarcolemma associated protein Gene [Source:MGI Symbol;Acc:MGI:1933549]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43948 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43948
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021231 Nonsense 55 376 3 9
ENSDART00000134865 None None 199 None 6

The following transcripts of ENSDARG00000020764 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 19881304)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19666411
GRCz11 23 19592754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGAACTGCAGGAGGCCAATGAACAGCCCAACTCCAGCAAATACAAATG[T/A]GTTGAACTTCAAGGTACAGGGTACTGAAAAGCTCGCATGTGCACTTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4205
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021231 Nonsense 169 376 5 9
ENSDART00000134865 None None 199 None 6

The following transcripts of ENSDARG00000020764 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 19883128)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19668235
GRCz11 23 19594578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAATGGCAGCAGGCWGCAAACAAGTACGAGCGCGAGCTTGAAAGTGTA[C/T]AGGCAAGTCACCWGCAGCAGAACCAGCAGAGGGACAGAGCCACCAAACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29903
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021231 Essential Splice Site 305 376 7 9
ENSDART00000134865 Essential Splice Site 127 199 3 6

The following transcripts of ENSDARG00000020764 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 19889601)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19674708
GRCz11 23 19601051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGGCAGCTGGAGCAGAGCAACAGCAGGATCAAAGAACTGCAGAAAGAG[G/A]TTAATCACACCATACCTAAGAAAGAAAGAAAGTAGAGCTGAGTCTCATTA
Associated Phenotype:
Not determined