Busch Lab

ZMP

caprin2

Ensembl ID:
ENSDARG00000020749
ZFIN ID:
ZDB-GENE-040812-2
Description:
Caprin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RJ80]
Human Orthologue:
CAPRIN2
Human Description:
caprin family member 2 [Source:HGNC Symbol;Acc:21259]
Mouse Orthologue:
Caprin2
Mouse Description:
caprin family member 2 Gene [Source:MGI Symbol;Acc:MGI:2448541]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12716 Nonsense Available for shipment Available now
sa6049 Nonsense Mutation detected in F1 DNA Not yet available
sa12256 Nonsense Available for shipment Available now
sa14869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12716
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 200 914 5 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location (Zv9):
Chromosome 4 (position 15694236)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16637076
GRCz11 4 16626052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTGCTACATGTCCACTCAAGACATGGAGGGTTTGATGGATTTGGCRT[C/G]ACTGGTGGGATGYAAAAGGGATTACAGCATTAGGTTTGCACTATTGGATA
Long Flanking Sequence:
CTGAAGAAGGGGGAAAAGCTGAATGAAGACCAACTGGTAACTGACTTTCATATCATATGTTGCATCTTAGGAAATCTTGTTTGTGTCGCTAACATGGGTTGTCATTGTAGGAAGCTGTGGGCAAGTACGATGAGGTGGTCCATAATCTGAAGTTTGCCAAAGAGCTCCAGAAGACCATCGGCTCCCTCACTCAAGATGCAAGTCTTGTGTCTTTGTGAAGTATAGCATAAAATTAGGTTAAAAAAATACTTGAGTGTTGTACTGAATTTCCTTTTTTTCCCCCCCTACTCTGTAGTTGCTGAAGGCTCAGCGTAAAGCCGTTCGCCAAGAGAAGCAAATGAAGACTGATGAGGAGAAGAGCCGTTTGAGTCTAATGCTCCAGGTGCAGTACGTCCTCCATAGTCTGCAGAGAGAGGACGTCCGGAAGAACTTCTGCAACACCAGACAATATTCCTGCTACATGTCCACTCAAGACATGGAGGGTTTGATGGATTTGGCAT[C/G]ACTGGTGGGATGTAAAAGGGATTACAGCATTAGGTTTGCACTATTGGATACTGCAATCTGTTTTTGCATTGTGCATACAATTATTTATCGGTATCCCCCATACCCCCCAAGTTATTGTAGCTAACTCAGAATTGCTATGCGTTTTACAATGTCAACCTTGTCCAAACATGTTTTTTGATGCAAAAGGACACAGCTCTCATGTAGGCACATTCAAGTGGAGCTTAAGTATGACATTAAGTGATGTATAATAAACTTCTTAATTAGTGGGAGGGGTTTACCGATAGGTCAACTATGCAACTATGCAGTTATCTATGGCTATAGCTTTGGATGCTTTCAGGTTTCATGTTGCAGTATTTGGTGTTTATCCTGTTGATTTAGCATGGTCTTCCTGTTGTTTCATGCTCTAGTTTGGAGGATCAGATGCGACGGGCTGCTATTGTTTACTGGGAGCTGCTGGAAGGGAATGAAAAACCGGTTGCTGGCTCGACATGTGAGTTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26269
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 307 914 9 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location (Zv9):
Chromosome 4 (position 15692950)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16635790
GRCz11 4 16624766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCACTAATGTCTGCATGATGGCAGTTTCTTAACAGACGATACATGCCT[G/T]AAACTGATGAGCGCAGACGAGGTGAAACCGCATCGCCTCGCAACTGGAAG
Long Flanking Sequence:
ATAAAAAAATAATTAAAGGTGCTTTTTTTTTTTAATTTATTCATTTGTTTTTTTAATTATTTAAAGCAGGCCGTTTACTAGGGTACAAATATGGTCCCTTTTTAAAGTTTTATTTTTAATATGACTGCTATCATTCATCTACAGACAAGCACATGAAGGAGAAGCTTCTTCGCCTAGTGGATTCTGGCTTTTTCGATAACATCCCGCTTCCTAAATCTGACAGTCAAGAGAAGACCGAAACCATAAAGCCTGATTCTCAATCCAGACCCAGTGGCCTCACCAGTAAGATTACTCTACATATTGTCATGAAGCAGACACTTTCACTAGCGCATAATTTATTGTATATTTCTTTGCTTTAGCGCTGGTAAAGCTGAGCTCAAATGAAGTGCCTTCCAAAGAGGTAAAAACAAGTAATGCATCAATTCATGATTTAAATGTTGTAAACAAGCAGGTCACTAATGTCTGCATGATGGCAGTTTCTTAACAGACGATACATGCCT[G/T]AAACTGATGAGCGCAGACGAGGTGAAACCGCATCGCCTCGCAACTGGAAGGAAGACTTTTTGGCCATGAAGGAGAGGGAGCCACCGGACTCCTGGGAAATGGAGGAGCTTGCTGATCCTCCTGCGTCCTCCCAGTCCCCCATACAGAAGCCATGGAAAGGAGCAGCGGGTTTGATTCCTAAAACTGTAGACATTGTGAAGAGATCCACGACTGACCCTAAAGAGGTGAAAAACTTGCCTGTTAAATTGTTTCCTTGCTCAATAATATTAATAATAATAATAATAATAATAAATAATAATAACAATAATAATCATTTTATTATTATTATTATTATTTTTGTTGTTGTATATAATTCATGACTTTTTTTTTTGCAAAAGTCTATTCACATTCTTATATCAATCGTTAAATGAAGTGGTCAACATTTAACATTTTGTTATTGTAATTACGAACTACTATAAAGTTCTCTTTACTGAAAGTTACTTGATGTATGATGTTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6049
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 384 914 10 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location (Zv9):
Chromosome 4 (position 15692089)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16634929
GRCz11 4 16623905
KASP Assay ID:
554-3814.1 (used for ordering genotyping assays)
KASP Sequence:
CATACTGTAGAGAAAATKTGTTAAACTTCTGTCTCTTTTTCTAGAAACGT[C/T]AAAGAAAGAAGGCTGAGCAAGACTCCAAATCTGTGAGTTTTTGATCAGAG
Long Flanking Sequence:
TTTTTTTTTTGCAAAAGTCTATTCACATTCTTATATCAATCGTTAAATGAAGTGGTCAACATTTAACATTTTGTTATTGTAATTACGAACTACTATAAAGTTCTCTTTACTGAAAGTTACTTGATGTATGATGTTTAGTGCACATTCAGGACATGTGGATTTGTATGGTCCTTTTTATTTCATTTATTTATTTTAGTGCAATTAAACTAACATTTCCATACTACAAAGACCCCCTGATGCACATTTGAAAGCAAATATAAATTGCTATTATTTGTGCTGTTCAATTAAATGACCCAATTAACTAATATGAATATAAAAAGAAATAATTTTTACTTATTTACAATATTCTCTGATGCTATAACATTTTTAAAACCTGTTGAAGATGTTGCTGTTTTACAACTTAGCATGTTGGTGGTTTACTCAGCTGTCAAGCTATTTGCAGCCTGCATGCATACTGTAGAGAAAATGTGTTAAACTTCTGTCTCTTTTTCTAGAAACGT[C/T]AAAGAAAGAAGGCTGAGCAAGACTCCAAATCTGTGAGTTTTTGATCAGAGGATCCAAACCTTTGTAAAATCATCAGTCAAGTGTAAAATTATTTTTTTTTTTTGGATTATATTTTCAGATGCCCGTTGCAGTGGAAGTCTTCAGTTCTCCATCTCCGTTACCAAAAGATCCCGTTCAGCGCCGGCAGCAGCTGGAGACACTGATGGACCAGATCTCTGGCTCCTTCAGTTTCATGCAGGCAAGCATTAAAGCAAGCAACTGTTTAATTTAAACAATCAGTGTTTTTTAAATCCCCAATATAATCCGTGTTTGCAGGAGTCTCTTTTGGATGGAGAATCTTCACCTGTCAACACTCAAACAAAAAGATGCCGTCCATCTCCAGGCTCCTCCACTCCAATCGGTACAGGAATGTTTCATATTAACACCGTAAGAATAGAATGGTGTTAAATTCACAGTTTGCTTGCATAGAACGGTAGTGATTATTACAGGATTTATCTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12256
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 390 914 10 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location (Zv9):
Chromosome 4 (position 15692071)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16634911
GRCz11 4 16623887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTAAACTTCTGTCTCTTTTTCTAGAAACGTYAAAGAAAGAAGGCTGAG[C/T]AAGACTCCAAATCTGTGAGTTTTTGATCAGAGGATCCANNNNAACCTTKGTAAA
Long Flanking Sequence:
CTATTCACATTCTTATATCAATCGTTAAATGAAGTGGTCAACATTTAACATTTTGTTATTGTAATTACGAACTACTATAAAGTTCTCTTTACTGAAAGTTACTTGATGTATGATGTTTAGTGCACATTCAGGACATGTGGATTTGTATGGTCCTTTTTATTTCATTTATTTATTTTAGTGCAATTAAACTAACATTTCCATACTACAAAGACCCCCTGATGCACATTTGAAAGCAAATATAAATTGCTATTATTTGTGCTGTTCAATTAAATGACCCAATTAACTAATATGAATATAAAAAGAAATAATTTTTACTTATTTACAATATTCTCTGATGCTATAACATTTTTAAAACCTGTTGAAGATGTTGCTGTTTTACAACTTAGCATGTTGGTGGTTTACTCAGCTGTCAAGCTATTTGCAGCCTGCATGCATACTGTAGAGAAAATGTGTTAAACTTCTGTCTCTTTTTCTAGAAACGTCAAAGAAAGAAGGCTGAG[C/T]AAGACTCCAAATCTGTGAGTTTTTGATCAGAGGATCCAAACCTTTGTAAAATCATCAGTCAAGTGTAAAATTATTTTTTTTTTTTGGATTATATTTTCAGATGCCCGTTGCAGTGGAAGTCTTCAGTTCTCCATCTCCGTTACCAAAAGATCCCGTTCAGCGCCGGCAGCAGCTGGAGACACTGATGGACCAGATCTCTGGCTCCTTCAGTTTCATGCAGGCAAGCATTAAAGCAAGCAACTGTTTAATTTAAACAATCAGTGTTTTTTAAATCCCCAATATAATCCGTGTTTGCAGGAGTCTCTTTTGGATGGAGAATCTTCACCTGTCAACACTCAAACAAAAAGATGCCGTCCATCTCCAGGCTCCTCCACTCCAATCGGTACAGGAATGTTTCATATTAACACCGTAAGAATAGAATGGTGTTAAATTCACAGTTTGCTTGCATAGAACGGTAGTGATTATTACAGGATTTATCTAGGCACATCATTAGTTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14869
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 438 914 12 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location (Zv9):
Chromosome 4 (position 15691763)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16634603
GRCz11 4 16623579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGTGTTTTTTAAATSCCCAATATAATNNNNGTTTGCAGGAGTCTCTTT[T/A]GGATGGAGAATCTTCACCTGYSAACWCTCAAACAAAAAGATGCCGTCCAT
Long Flanking Sequence:
TTTTTACTTATTTACAATATTCTCTGATGCTATAACATTTTTAAAACCTGTTGAAGATGTTGCTGTTTTACAACTTAGCATGTTGGTGGTTTACTCAGCTGTCAAGCTATTTGCAGCCTGCATGCATACTGTAGAGAAAATGTGTTAAACTTCTGTCTCTTTTTCTAGAAACGTCAAAGAAAGAAGGCTGAGCAAGACTCCAAATCTGTGAGTTTTTGATCAGAGGATCCAAACCTTTGTAAAATCATCAGTCAAGTGTAAAATTATTTTTTTTTTTTGGATTATATTTTCAGATGCCCGTTGCAGTGGAAGTCTTCAGTTCTCCATCTCCGTTACCAAAAGATCCCGTTCAGCGCCGGCAGCAGCTGGAGACACTGATGGACCAGATCTCTGGCTCCTTCAGTTTCATGCAGGCAAGCATTAAAGCAAGCAACTGTTTAATTTAAACAATCAGTGTTTTTTAAATCCCCAATATAATCCGTGTTTGCAGGAGTCTCTTT[T/A]GGATGGAGAATCTTCACCTGTCAACACTCAAACAAAAAGATGCCGTCCATCTCCAGGCTCCTCCACTCCAATCGGTACAGGAATGTTTCATATTAACACCGTAAGAATAGAATGGTGTTAAATTCACAGTTTGCTTGCATAGAACGGTAGTGATTATTACAGGATTTATCTAGGCACATCATTAGTTTTAAATTGATTGTTCCCCCATTATAGGGCTGGGCGATTTTGCCCTAATCAATCTCTATTAATTGAACATTTGAACTATTACGATTAATGAAGGTTTGTTTTATTTATTAAATTTTGCCCTCATAGTTCACTGACCGATTTTGTACAGGAAATATGTAAGCATATTTTAAGTGAGATTGCTGAATGAAGGGTGCATTACTTAATTTTTTAATTAAAGGAAACGCACAGTCTACTATCTATGATTATTTATTGAACATCAACATTGAGTAACTGAAATTAAACCACACATTGCCACATTTTTGTCTTTAATAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5256
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Essential Splice Site 708 914 20 21
ENSDART00000064009 Essential Splice Site 125 331 5 6
ENSDART00000125323 Essential Splice Site 123 329 5 7
Genomic Location (Zv9):
Chromosome 4 (position 15684756)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16627596
GRCz11 4 16616572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCAATGATGTACTTTTGACCCTGCTAATTGTAGTTTNGGTTGCATTATC[A/T]GGAAAACGGCTATCAGCAAAACTTCAAGAGAGGAGCAGGCACAGCAACTC
Long Flanking Sequence:
ATATTTAAATTGATTTATTAATTTTTTTTAAATGTATATTTAACAAATTGTGAATTTCGCTAATTCATAAAAACAATCCAATTTTAGCCATTGTGTTATGAATAGTCTCAAATTACATTAACAAATGTGTAATGTTTTTAAATTCAATGCATCGTGATCAGTTGCATAATTGTTCATTTTGCATTGTAGATGTTGGGTTTTGTTCTAACCATTCTAAATTCAATTTCATGTATAAGCAATCCAAAATATGTTAAGACTTTGCATTGTAGAATCTATTTTATAAATTTTTTAAATTAATTTGTATTGTGTATATTAGTTATATAGTCAGGATATTGCTTTTACTTAAACACATGCTGTACACATTTGTATTGTAGGCTTCATGTCATTTCGCATGGTAGGTATAATTAATAAAAAATACATAAAGTATATTAGACGTTCTATATCAGCTTTGTCAATGATGTACTTTTGACCCTGCTAATTGTAGTTTTGGTTGCATTATC[A/T]GGAAAACGGCTATCAGCAAAACTTCAAGAGAGGAGCAGGCACAGCAACTCAGAGGAGCAGCGGTATGATTATTTTAAAAAGTGCTTTACGCAATCCAAAAGAAACTGAAAATTTAAGCAGTCTTTATATCATCCATAGATTGCTATATACATATATTTTATGTAGATGAATATTTGTCTGACTACTGTTGTATATTTGATTATCATGCTGATAATGAGTGTAATTTATATTATTATTATTATTATTATTACTATTATTATTATTAAGTAATTTGTGCTTTTTAACTTGCCTCCATTTAAGCCGGCTGGAGCGACTCTTCTCAAGTGAGCAGTCCGGATCGAGATGGGGCGTATCCTCTGGATTCAGGACTTAGTGACACCCTGTCTATCCCGGCCATGGAGGTGCCCATGAATCCACAAGGCCCGCACACCCTGATGCCTGTCCATGTGTACCCACTCACCCAGCTCCGTGTGGCATTCTCTGCTGCTCGCACCGCCAAC
Associated Phenotype:
Not determined