Busch Lab

ZMP

gfi1.1

Ensembl ID:
ENSDARG00000020746
ZFIN ID:
ZDB-GENE-050522-534
Description:
growth factor independent 1.1 [Source:RefSeq peptide;Acc:NP_001018612]
Human Orthologue:
GFI1
Human Description:
growth factor independent 1 transcription repressor [Source:HGNC Symbol;Acc:4237]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa9056 Nonsense Mutation detected in F1 DNA Not yet available
sa11633 Nonsense Available for shipment Available now
sa16850 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9056
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 101 385 4 7
ENSDART00000136677 Nonsense 4 288 1 4
Genomic Location (Zv9):
Chromosome 2 (position 10567708)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10992804
GRCz11 2 10776403
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGNCAAAATAGCTCATTATACTTTTTCATATCTGACTGTAGATCTGGAT[A/T]AATGCCCGGTTCCTTCTCCAGACGACTCTCAGCCTTTCGACATGTCCTTC
Long Flanking Sequence:
TGCTTATACAAATTGTAAAGTTTTAAAATATAAAATTTAATAATTTATTTTCTTTTCAGCTTAGTATCTTTATTAATCAGGGGTCACCACAGCGGAATGAACCACCAACTTATCCAGCATATGTTTCACGCAGAGGATGCCCTTCACAGCCAATATAAAATTGTAAAACAAAAAAATATATACTTTTACTGTAATAAAACAGTAATAAAAGCAAAAATGTTTTAGGGTTCCATTATGCAATTAAGTTAACGTAAATAATTTGAATGGATTGAACTTAAAACAATTAAGTTGTCCCAAAAAATGTCAATTGCTGAGTTGTTTCAGCTCATTTTAAATAAGTAGTTTAAACAAGCAGCAAACATATGTTTGGAGTGTACTGTAAGTCTATTTTACAGTAATTATGTCAATACATGCGACAATTTTTGTACTACAAAGTTTTTTTTACAGTGTAATGCAAAATAGCTCATTATACTTTTTCATATCTGACTGTAGATCTGGAT[A/T]AATGCCCGGTTCCTTCTCCAGACGACTCTCAGCCTTTCGACATGTCCTTCCGTCCATACGTTTGGTCTCATTCATCATCTGAGCTCAGGCATCTCATTCAGTCCTGCAATCGTGTTTCTGTGGATTCAGACTCGTCAGTGGGGGTTTACGATGCTATGGACAGAAGGCCGAGCGCTCATCTCCTCATCCAACCAACACAATCTAGGCGATTTTACCAGGACTATGGCTCCCTGACCCCTAACCTGCTGGATAATCGAGGCTTTTACACTGACTTCAAGATGTCGACTAAAGTAGCAGAGACTGATTCAGAGTCAGATATGACGTGCACACGACTTCAACTAAGCGGGTCCTACAAATGCATAAAATGCACTAAGGTATAAAAAATTTAGATTCAGAATATTTTGCTTCTTATAGATACTCAAGCATTATTATCAGTCGCTGCATTGAAAAAAAAAAATCTTAAAGTCGCAAAATTAAATGGCTTTTTTCGATTCTTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11633
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 145 385 4 7
ENSDART00000136677 Nonsense 48 288 1 4
Genomic Location (Zv9):
Chromosome 2 (position 10567841)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10992937
GRCz11 2 10776536
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCAGGCATCTCATTCAGTCCTGCAATCGTGTTTCTGTGGATTCAGACT[C/A]GTCAGTGGGRGTTTAYGATGCTATGGACAGAAGGYCGAGCGCTCATCTCC
Long Flanking Sequence:
AGGATGCCCTTCACAGCCAATATAAAATTGTAAAACAAAAAAATATATACTTTTACTGTAATAAAACAGTAATAAAAGCAAAAATGTTTTAGGGTTCCATTATGCAATTAAGTTAACGTAAATAATTTGAATGGATTGAACTTAAAACAATTAAGTTGTCCCAAAAAATGTCAATTGCTGAGTTGTTTCAGCTCATTTTAAATAAGTAGTTTAAACAAGCAGCAAACATATGTTTGGAGTGTACTGTAAGTCTATTTTACAGTAATTATGTCAATACATGCGACAATTTTTGTACTACAAAGTTTTTTTTACAGTGTAATGCAAAATAGCTCATTATACTTTTTCATATCTGACTGTAGATCTGGATAAATGCCCGGTTCCTTCTCCAGACGACTCTCAGCCTTTCGACATGTCCTTCCGTCCATACGTTTGGTCTCATTCATCATCTGAGCTCAGGCATCTCATTCAGTCCTGCAATCGTGTTTCTGTGGATTCAGACT[C/A]GTCAGTGGGGGTTTACGATGCTATGGACAGAAGGCCGAGCGCTCATCTCCTCATCCAACCAACACAATCTAGGCGATTTTACCAGGACTATGGCTCCCTGACCCCTAACCTGCTGGATAATCGAGGCTTTTACACTGACTTCAAGATGTCGACTAAAGTAGCAGAGACTGATTCAGAGTCAGATATGACGTGCACACGACTTCAACTAAGCGGGTCCTACAAATGCATAAAATGCACTAAGGTATAAAAAATTTAGATTCAGAATATTTTGCTTCTTATAGATACTCAAGCATTATTATCAGTCGCTGCATTGAAAAAAAAAAATCTTAAAGTCGCAAAATTAAATGGCTTTTTTCGATTCTTTGTAAAAATTTCATATTTAATCCCGCTGCTTATGGAAGCAGAATTGTAGCTTCGACTTTAACCTCACAATTTAGACTTTTAATTGTCAGAATATGTAGTTTGCATGTTTTATATACAGTTAGGGCCATAAATAATTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18719
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 238 385 5 7
ENSDART00000136677 Nonsense 141 288 2 4
Genomic Location (Zv9):
Chromosome 2 (position 10570766)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10995862
GRCz11 2 10779461
KASP Assay ID:
2259-1638.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATTTGTAATTAGGTGTTTTCCACTCCCCATGGCTTGGAAGTTCACGTG[C/T]GAAGGTCACACAGCGGCACAAGGCCCTTTGCCTGCGAAATCTGTGGCAAA
Long Flanking Sequence:
AATTTGTGGGTTGCAGTTTTCTGTTATATAAATTTGGAATTATGGATGATAAAATGTTTGGGCAATTTAAACTTTTTTCTTAGAATTATAGAATGTATACTCCAAATTGTCAACCAAACAGAATTGCAAGAATGTATACTTGACTAGTTTGACCATGGTATTTGAAGTAAAACGTTATCTAATTGGATGAGTTATCCAATGGCAATCAAAATCAAAACATTATCCATTTGACAACCAATACTGCCATAAACACTGTTACTTCTTTTTTTTGTATAGGAAATCCAAGTTTCATTTTCATATGCTTGGTCAAAATTGTGGACTTTTATGTCTAAATTGCTTTAGACCAATACAATTTTGATAAGTATAAAATATTATACTTTAAAGATATGAATGTAAACTACACTGTTTCAAACAAATCACTGTTTTTTCTTCTAAAGACTTGTGTGCTTTTAATTTGTAATTAGGTGTTTTCCACTCCCCATGGCTTGGAAGTTCACGTG[C/T]GAAGGTCACACAGCGGCACAAGGCCCTTTGCCTGCGAAATCTGTGGCAAAACCTTCGGCCACGCCGTCAGTCTGGAGCAACATAAAGCCGTCCATTCACAAGTACGCTTCAATTCTCACAACATTCAATAGTAATGTCAGAATTGTAAACCTGGATGATACTTACTCATGATCGTTTATTTGCAGGAAAGGGTCTTCAGCTGTAAAATCTGTGACAAAAGCTTTAAGAGATCGTCCACTTTGTCCACGCACCTTCTCATCCACTCGGACACCAGACCGTATCCCTGTCAGTACTGCGGAAAACGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGGTGAATCATTTTAGCATTCAACACAAAGATTTGCTTACTATGGGGAGACACATATCATTACTTACCATTGGAAAAACTGTAATGCTAACTTGGTTACACAGAGCACATCTTAACCAATCACAAAGCAGCTTTTGCTCTCTATGTGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16850
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 309 385 6 7
ENSDART00000136677 Nonsense 212 288 3 4
Genomic Location (Zv9):
Chromosome 2 (position 10571063)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10996159
GRCz11 2 10779758
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCACCTTCTCATCCACTCGGACACCAGACCGTATCCCTGTCAGTACTGC[G/T]GAAAACGYTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCAT
Long Flanking Sequence:
TATGCTTGGTCAAAATTGTGGACTTTTATGTCTAAATTGCTTTAGACCAATACAATTTTGATAAGTATAAAATATTATACTTTAAAGATATGAATGTAAACTACACTGTTTCAAACAAATCACTGTTTTTTCTTCTAAAGACTTGTGTGCTTTTAATTTGTAATTAGGTGTTTTCCACTCCCCATGGCTTGGAAGTTCACGTGCGAAGGTCACACAGCGGCACAAGGCCCTTTGCCTGCGAAATCTGTGGCAAAACCTTCGGCCACGCCGTCAGTCTGGAGCAACATAAAGCCGTCCATTCACAAGTACGCTTCAATTCTCACAACATTCAATAGTAATGTCAGAATTGTAAACCTGGATGATACTTACTCATGATCGTTTATTTGCAGGAAAGGGTCTTCAGCTGTAAAATCTGTGACAAAAGCTTTAAGAGATCGTCCACTTTGTCCACGCACCTTCTCATCCACTCGGACACCAGACCGTATCCCTGTCAGTACTGC[G/T]GAAAACGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGGTGAATCATTTTAGCATTCAACACAAAGATTTGCTTACTATGGGGAGACACATATCATTACTTACCATTGGAAAAACTGTAATGCTAACTTGGTTACACAGAGCACATCTTAACCAATCACAAAGCAGCTTTTGCTCTCTATGTGAACTGTCACAGAGTTGGCATTAGCAATAGCTGTTATGCTTTTTAGGCTAATCGTTTAATCATTAGGCTTGCCTTCAATAGGTTTTGACAACAGACACTGTGAATTTTCTCGTGTAAAAGTACTGCTGATGTATTTGACTATTTAAAGGGATAGTGCACCCAAAAATGAAAATTCGGCCATCATTTGCTCAATTATTCCAAACCGCTTTGAGTTTCTCTCTTCTATTAAACACAAAGGAAGATATTCTAATGTTGGAAAAAAGCAGCCTATGGCTATGTTTCCATCCAAATATACAACTTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18720
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
Genomic Location (Zv9):
Chromosome 2 (position 10571119)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10996215
GRCz11 2 10779814
KASP Assay ID:
2259-1640.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGG[T/C]GAATCATTTTAGCATTCAACACAAAGATTTGCTTACTATGGGGAGACACA
Long Flanking Sequence:
TTTGATAAGTATAAAATATTATACTTTAAAGATATGAATGTAAACTACACTGTTTCAAACAAATCACTGTTTTTTCTTCTAAAGACTTGTGTGCTTTTAATTTGTAATTAGGTGTTTTCCACTCCCCATGGCTTGGAAGTTCACGTGCGAAGGTCACACAGCGGCACAAGGCCCTTTGCCTGCGAAATCTGTGGCAAAACCTTCGGCCACGCCGTCAGTCTGGAGCAACATAAAGCCGTCCATTCACAAGTACGCTTCAATTCTCACAACATTCAATAGTAATGTCAGAATTGTAAACCTGGATGATACTTACTCATGATCGTTTATTTGCAGGAAAGGGTCTTCAGCTGTAAAATCTGTGACAAAAGCTTTAAGAGATCGTCCACTTTGTCCACGCACCTTCTCATCCACTCGGACACCAGACCGTATCCCTGTCAGTACTGCGGAAAACGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGG[T/C]GAATCATTTTAGCATTCAACACAAAGATTTGCTTACTATGGGGAGACACATATCATTACTTACCATTGGAAAAACTGTAATGCTAACTTGGTTACACAGAGCACATCTTAACCAATCACAAAGCAGCTTTTGCTCTCTATGTGAACTGTCACAGAGTTGGCATTAGCAATAGCTGTTATGCTTTTTAGGCTAATCGTTTAATCATTAGGCTTGCCTTCAATAGGTTTTGACAACAGACACTGTGAATTTTCTCGTGTAAAAGTACTGCTGATGTATTTGACTATTTAAAGGGATAGTGCACCCAAAAATGAAAATTCGGCCATCATTTGCTCAATTATTCCAAACCGCTTTGAGTTTCTCTCTTCTATTAAACACAAAGGAAGATATTCTAATGTTGGAAAAAAGCAGCCTATGGCTATGTTTCCATCCAAATATACAACTTAGACTTAAAATTAGAGCAAAACTGGAATATTACATTGAATTTTTGCAAATTAATCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8077
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
Genomic Location (Zv9):
Chromosome 2 (position 10571119)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10996215
GRCz11 2 10779814
KASP Assay ID:
2259-1640.1 (used for ordering genotyping assays)
KASP Sequence:
CGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGG[T/C]GAATCATTTTAGCATTCAACACAAAKATTTGCTTACTATGGGGAGAYACA
Long Flanking Sequence:
TTTGATAAGTATAAAATATTATACTTTAAAGATATGAATGTAAACTACACTGTTTCAAACAAATCACTGTTTTTTCTTCTAAAGACTTGTGTGCTTTTAATTTGTAATTAGGTGTTTTCCACTCCCCATGGCTTGGAAGTTCACGTGCGAAGGTCACACAGCGGCACAAGGCCCTTTGCCTGCGAAATCTGTGGCAAAACCTTCGGCCACGCCGTCAGTCTGGAGCAACATAAAGCCGTCCATTCACAAGTACGCTTCAATTCTCACAACATTCAATAGTAATGTCAGAATTGTAAACCTGGATGATACTTACTCATGATCGTTTATTTGCAGGAAAGGGTCTTCAGCTGTAAAATCTGTGACAAAAGCTTTAAGAGATCGTCCACTTTGTCCACGCACCTTCTCATCCACTCGGACACCAGACCGTATCCCTGTCAGTACTGCGGAAAACGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGG[T/C]GAATCATTTTAGCATTCAACACAAAGATTTGCTTACTATGGGGAGACACATATCATTACTTACCATTGGAAAAACTGTAATGCTAACTTGGTTACACAGAGCACATCTTAACCAATCACAAAGCAGCTTTTGCTCTCTATGTGAACTGTCACAGAGTTGGCATTAGCAATAGCTGTTATGCTTTTTAGGCTAATCGTTTAATCATTAGGCTTGCCTTCAATAGGTTTTGACAACAGACACTGTGAATTTTCTCGTGTAAAAGTACTGCTGATGTATTTGACTATTTAAAGGGATAGTGCACCCAAAAATGAAAATTCGGCCATCATTTGCTCAATTATTCCAAACCGCTTTGAGTTTCTCTCTTCTATTAAACACAAAGGAAGATATTCTAATGTTGGAAAAAAGCAGCCTATGGCTATGTTTCCATCCAAATATACAACTTAGACTTAAAATTAGAGCAAAACTGGAATATTACATTGAATTTTTGCAAATTAATCAGC
Associated Phenotype:
Not determined