Busch Lab

ZMP

si:ch211-251j10.4

Ensembl ID:
ENSDARG00000020702
ZFIN ID:
ZDB-GENE-041008-119
Description:
outer dense fiber of sperm tails 2-like [Source:RefSeq peptide;Acc:NP_001116704]
Human Orthologue:
ODF2
Human Description:
outer dense fiber of sperm tails 2 [Source:HGNC Symbol;Acc:8114]
Mouse Orthologue:
Odf2
Mouse Description:
outer dense fiber of sperm tails 2 Gene [Source:MGI Symbol;Acc:MGI:1098824]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa21332 Nonsense Available for shipment Available now
sa31661 Nonsense Available for shipment Available now
sa7142 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21332
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077361 Nonsense 62 799 2 19
ENSDART00000124213 Nonsense 62 234 2 7
ENSDART00000130870 Nonsense 62 173 3 5
ENSDART00000143604 Nonsense 62 810 2 18

The following transcripts of ENSDARG00000020702 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31864820)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31007546
GRCz11 8 31016778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGGTCCGAGCTCCATGGGTTCCTCCTGGAAAGAGCTCAACACGAAGA[C/T]AGTACAAATGGGAGGTTTGTTTAGCCCTGTTTTACTTTATTCACCAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31661
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077361 Nonsense 347 799 10 19
ENSDART00000124213 None None 234 None 7
ENSDART00000130870 None None 173 None 5
ENSDART00000143604 Nonsense 352 810 9 18

The following transcripts of ENSDARG00000020702 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31868161)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31010887
GRCz11 8 31020119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACCCGCAGTCGCTTGCAGAACAATCTGCTTAAGAAGGAAGCTGAAAAT[A/T]AACGTCAGGAGGCTCAGATCCAAGTAAGCCAACAAATTTATACTTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7142
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077361 Nonsense 461 799 13 19
ENSDART00000124213 None None 234 None 7
ENSDART00000130870 None None 173 None 5
ENSDART00000143604 Nonsense 466 810 12 18

The following transcripts of ENSDARG00000020702 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31871982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31014708
GRCz11 8 31023940
KASP Assay ID:
554-5109.1 (used for ordering genotyping assays)
KASP Sequence:
TAAGTGTTGTCTCTTTGCAGTCGTCTCAGTGAGTTGAGTGATCAGTTGTG[C/A]AGTTGTGAGCAGAAGTCCTGTGCYGAGAGAGAGGGTCTTCTCAACCGTCT
Associated Phenotype:
Not determined