Busch Lab

ZMP

slc9a8

Ensembl ID:
ENSDARG00000020699
ZFIN ID:
ZDB-GENE-041212-7
Description:
sodium/hydrogen exchanger 8 [Source:RefSeq peptide;Acc:NP_001008586]
Human Orthologue:
SLC9A8
Human Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 8 [Source:HGNC Symbol;Acc:20728]
Mouse Orthologue:
Slc9a8
Mouse Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 8 Gene [Source:MGI Symbol;Acc:MGI:192428

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17328 Nonsense Available for shipment Available now
sa17290 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17328
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021062 Nonsense 177 512 7 14
Genomic Location (Zv9):
Chromosome 23 (position 4015311)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4019814
GRCz11 23 3962717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CYRTGCTTGATGTWGTTTGTCTTTCAGTACAGCGGAGGGCTTCGGGGGCT[C/A]GGACGTCTCTACAGGATGGGAAACYTTCATGCAGGCGCTGGGATACTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17290
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021062 Nonsense 350 512 11 14
Genomic Location (Zv9):
Chromosome 23 (position 4010666)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4015169
GRCz11 23 3958072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTCTTCAGAGACCATAAAATCACCCCCAARATGATGTTCATCATGTG[G/A]TTCAGYGGTAAGAGGATGATRAATTCCAATTTCTTYRTGGCTTRAAGTAA
Associated Phenotype:
Not determined