Busch Lab

ZMP

slc7a3

Ensembl ID:
ENSDARG00000020645
ZFIN ID:
ZDB-GENE-041114-206
Description:
solute carrier family 7, member 3 [Source:RefSeq peptide;Acc:NP_001007330]
Human Orthologue:
SLC7A3
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 [Source:HGNC Symbol;A
Mouse Orthologues:
AU018091, Slc7a3
Mouse Descriptions:
expressed sequence AU018091 Gene [Source:MGI Symbol;Acc:MGI:2142124]
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene [Source:MGI Symb

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23972 Nonsense Available for shipment Available now
sa43672 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23972
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043727 Nonsense 83 644 2 12

The following transcripts of ENSDARG00000020645 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29260953)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30480197
GRCz11 21 30516892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATGCTTCCTCGTGGCCGCTCTTTCCTCCATGCTGGCTGGATTGTGCTA[T/A]GCAGAATTCGGCGCTCGAGTCCCGAAGACTGGATCTGCATACTTGTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43672
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043727 Nonsense 129 644 3 12

The following transcripts of ENSDARG00000020645 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29263973)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30483217
GRCz11 21 30519912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATTGCTGGTGTGTGTGCTTTTTTTTTTTAGGTACAGCTAGCGTGGCT[C/T]GAGCTTGGAGCTCTACGTTTGATAACTTGATTGAGCAGAAGATCTCCAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6678
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043727 Essential Splice Site 348 644 7 12
ENSDART00000043727 Essential Splice Site 348 644 7 12

The following transcripts of ENSDARG00000020645 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29269578)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30488822
GRCz11 21 30525517
KASP Assay ID:
554-4561.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTAACATTWATCTGAATGTGATGTTTTTTTTTTTTTTTTTTCCGCTTA[G/T]TTTGCTGGGCTCCATGTTCCCTATGCCTCGAGTGATTTACGCCATGGCYG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29626
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043727 Essential Splice Site 348 644 7 12
ENSDART00000043727 Essential Splice Site 348 644 7 12

The following transcripts of ENSDARG00000020645 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29269578)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30488822
GRCz11 21 30525517
KASP Assay ID:
554-4561.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTAACATTTATCTGAATGTGATGTTTTTTTTTTTTTTTTTTCCGCTTA[G/A]TTTGCTGGGCTCCATGTTCCCTATGCCTCGAGTGATTTACGCCATGGCTG
Associated Phenotype:
Not determined