Busch Lab

ZMP

gtdc1

Ensembl ID:
ENSDARG00000020642
ZFIN ID:
ZDB-GENE-050417-8
Description:
Glycosyltransferase-like domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q568B7]
Human Orthologue:
GTDC1
Human Description:
glycosyltransferase-like domain containing 1 [Source:HGNC Symbol;Acc:20887]
Mouse Orthologue:
Gtdc1
Mouse Description:
glycosyltransferase-like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2444269]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9220 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10288 Essential Splice Site Available for shipment Available now
sa34657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9220
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
Genomic Location (Zv9):
Chromosome 9 (position 26904582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26060368
GRCz11 9 25871237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCAAGTGTCACGTCCTCCACTTCCCCATTCGCTTTCCCGATGTCACAAG[G/A]TCTGTCCTTACATCCCTCACCACAGCCTTCCAGGGATCACTCCTCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10288
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
Genomic Location (Zv9):
Chromosome 9 (position 26904582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26060368
GRCz11 9 25871237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCAAGTGTCACGTCCTCCACTTCCCCATTCGCTTTCCCGATGTCACAAG[G/A]TCTGTCCTTACATCCCTCACCACAGCCTTCCAGGGATCACTCCTCCACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2539
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 5 11
ENSDART00000127135 Essential Splice Site 174 433 4 10
Genomic Location (Zv9):
Chromosome 9 (position 26920563)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26076349
GRCz11 9 25887218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAGTTTCTCTTATGTTGCTTTATAGGGCTTTTTTCCCTTTCGTCCTCA[G/A]ATTCCTCCCTGCACACAAGCGTCTCAGGCATCCAGTGCGGTGTGATGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34657
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Nonsense 379 433 10 11
ENSDART00000127135 Nonsense 379 433 9 10
Genomic Location (Zv9):
Chromosome 9 (position 26942374)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26098160
GRCz11 9 25909029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATATGTATTTTCCTCTTGTAGCAACATATCTGTATTCAACACCTGAA[C/T]AGCTGTGCAAAAGACTACAGGAATTCTGCAAGCGTCCGCAATTAGCCAGA
Associated Phenotype:
Not determined