Busch Lab

ZMP

baxa

Ensembl ID:
ENSDARG00000020623
ZFIN ID:
ZDB-GENE-000511-6
Description:
bcl2-associated X protein, a [Source:RefSeq peptide;Acc:NP_571637]
Human Orthologue:
BAX
Human Description:
BCL2-associated X protein [Source:HGNC Symbol;Acc:959]
Mouse Orthologue:
Bax
Mouse Description:
BCL2-associated X protein Gene [Source:MGI Symbol;Acc:MGI:99702]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6041 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6041
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011691 Nonsense 20 192 2 6

The following transcripts of ENSDARG00000020623 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 37776347)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37639707
GRCz11 3 37781565
KASP Assay ID:
554-3873.1 (used for ordering genotyping assays)
KASP Sequence:
TTAAGTTCTCTATAAYTCTGTAGGCAGTGGCAATGACCAGATACTTGACT[T/A]GGGAGCTGCACTTCTCAACAAGTGAGTATTATTTTTATCTCCCCTTNCTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8138
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011691 Nonsense 54 192 3 6

The following transcripts of ENSDARG00000020623 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 37776164)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37639524
GRCz11 3 37781382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACAGGGATGCTGAAGTGACCCGGAGTCAGCTTGGGGGCGTGGAGCTGTG[T/A]GACCCCAGCCATAAACGCCTCGCGCAGTGTTTGCAGCAGATCGGAGATGA
Associated Phenotype:
Not determined