Busch Lab

ZMP

ap1b1

Ensembl ID:
ENSDARG00000020621
ZFIN IDs:
ZDB-GENE-030131-6932, ZDB-GENE-061025-1, ZDB-GENE-061025-1, ZDB-GENE-061025-1
Description:
AP-1 complex subunit beta-1 [Source:RefSeq peptide;Acc:NP_001122002]
Human Orthologue:
AP1B1
Human Description:
adaptor-related protein complex 1, beta 1 subunit [Source:HGNC Symbol;Acc:554]
Mouse Orthologue:
Ap1b1
Mouse Description:
adaptor protein complex AP-1, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1096368]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18117 Nonsense Available for shipment Available now
sa20411 Essential Splice Site Available for shipment Available now
sa26468 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18117
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Nonsense 70 947 3 21
ENSDART00000137128 Nonsense 70 947 4 22
ENSDART00000140042 Nonsense 70 125 4 5
Genomic Location (Zv9):
Chromosome 5 (position 26472413)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24299678
GRCz11 5 24803478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGTCAACTGCATGCAGACAGAKAACCTGGAACTGAAAAAGCTGGTCTA[T/A]CTGTACTTGATGAATWATGCCAAGAGCCAGCCAGACATGGCCATTATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Essential Splice Site 353 947 7 21
ENSDART00000137128 Essential Splice Site 353 947 8 22
ENSDART00000140042 None None 125 None 5
Genomic Location (Zv9):
Chromosome 5 (position 26465310)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24292575
GRCz11 5 24796375
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGCTGGATATAATGATCCGCCTGGCCTCTCAGGCCAACATTGCTCAGG[T/C]AAACACATTACACATATGGATGCTCTTAAGTTAAAGTTTTGGAATGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26468
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Nonsense 861 947 19 21
ENSDART00000137128 Nonsense 861 947 20 22
ENSDART00000140042 None None 125 None 5
Genomic Location (Zv9):
Chromosome 5 (position 26439268)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24266533
GRCz11 5 24770333
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAAGTGTTTTTGGCCACCTGGAAGGACATCCCAAATGACAACGAGGCA[C/T]AGTTCCAAATCAAAGACGTACACCTCAACTCAGGTAATGGGAATAAATGG
Associated Phenotype:
Not determined